Incidental Mutation 'R6365:Kctd13'
ID512638
Institutional Source Beutler Lab
Gene Symbol Kctd13
Ensembl Gene ENSMUSG00000030685
Gene Namepotassium channel tetramerisation domain containing 13
SynonymsPdip1, Poldip1, 1500003N18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.240) question?
Stock #R6365 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location126928879-126945631 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 126930690 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 101 (R101Q)
Ref Sequence ENSEMBL: ENSMUSP00000032924 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032924]
Predicted Effect probably damaging
Transcript: ENSMUST00000032924
AA Change: R101Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032924
Gene: ENSMUSG00000030685
AA Change: R101Q

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 18 32 N/A INTRINSIC
BTB 41 141 6.48e-15 SMART
low complexity region 276 314 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141369
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.8%
Validation Efficiency 98% (57/58)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced synaptic transmission, abnormal hippocampal pyramidal neuron dendrite morphology, and hyperactivity with no detectable changes in body weight, brain size or neurogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik G T 5: 113,182,644 R1235S probably benign Het
Abca9 T A 11: 110,145,655 I543F possibly damaging Het
Acot6 A G 12: 84,109,412 E378G probably benign Het
Adam30 T C 3: 98,161,034 L61S probably damaging Het
Agap3 T A 5: 24,474,985 L227Q probably benign Het
Ap5m1 T C 14: 49,078,828 I285T probably benign Het
Atp2a2 A G 5: 122,461,916 Y497H probably benign Het
Bace1 C T 9: 45,854,676 Q17* probably null Het
Calcr T C 6: 3,711,455 I189V probably benign Het
Cd48 A T 1: 171,682,164 Q24L probably null Het
Cnga1 T C 5: 72,604,945 I409V probably benign Het
Ctsd G A 7: 142,385,577 T37M probably benign Het
Cyp2c29 T C 19: 39,307,754 S171P probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Drd2 A T 9: 49,406,949 N397I probably damaging Het
Dst A G 1: 34,191,927 E3045G probably damaging Het
Dzip3 T A 16: 48,931,273 R764S probably damaging Het
Exosc10 T C 4: 148,561,105 V114A probably benign Het
Fam234a C A 17: 26,220,455 E32* probably null Het
Fbxw11 C A 11: 32,720,623 D162E possibly damaging Het
Fcho2 A T 13: 98,789,859 M72K probably benign Het
Fech T C 18: 64,458,180 N391S probably benign Het
Foxp2 T C 6: 15,286,685 L58P probably damaging Het
Gdi2 A G 13: 3,565,093 D430G possibly damaging Het
Gm11639 A G 11: 104,924,586 E3247G unknown Het
Grm8 C T 6: 27,363,227 C763Y probably damaging Het
Hibch T A 1: 52,868,937 probably null Het
Hist1h2be C T 13: 23,585,658 R100H probably benign Het
Ifi44l C T 3: 151,761,505 V63I unknown Het
Igf1r G T 7: 68,190,050 A702S probably benign Het
Klhl33 T C 14: 50,891,837 D645G probably benign Het
Lrrc6 A T 15: 66,454,134 S197R probably benign Het
Mylk A G 16: 34,860,591 T74A probably benign Het
Myo1f A G 17: 33,586,116 S453G probably benign Het
Naxe A G 3: 88,057,991 V105A probably damaging Het
Nid2 A G 14: 19,803,133 Y1140C probably damaging Het
Nlrp12 T C 7: 3,239,888 T665A probably benign Het
Olfr630 T A 7: 103,755,195 H130L probably benign Het
Otud7b T G 3: 96,155,250 I602S probably benign Het
Palm2 G T 4: 57,709,675 G207* probably null Het
Papolg T C 11: 23,882,290 D166G probably damaging Het
Pbx4 T G 8: 69,872,207 probably null Het
Pdcd4 T C 19: 53,922,133 probably null Het
Pde2a C T 7: 101,510,363 T800I probably damaging Het
Polk A T 13: 96,484,009 V582E probably damaging Het
Prss40 A G 1: 34,552,517 probably benign Het
Robo4 G T 9: 37,410,712 R597L probably benign Het
Scg2 T A 1: 79,435,300 I529F probably benign Het
Sema7a T C 9: 57,954,905 F180L probably benign Het
Sowahc T C 10: 59,223,527 L495P probably damaging Het
Trf A G 9: 103,222,128 V324A possibly damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Vip C T 10: 5,644,021 R125* probably null Het
Vmn1r159 T A 7: 22,843,401 T69S probably damaging Het
Vmn1r202 A T 13: 22,502,204 F14L probably benign Het
Vmn1r53 T C 6: 90,224,259 N28D probably damaging Het
Vmn2r58 T A 7: 41,864,183 K345N probably benign Het
Zbtb17 G A 4: 141,463,383 G171S probably benign Het
Zbtb8os A T 4: 129,343,152 N120I possibly damaging Het
Zfp959 T A 17: 55,897,785 L274H probably damaging Het
Other mutations in Kctd13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02617:Kctd13 APN 7 126942332 missense possibly damaging 0.64
IGL02890:Kctd13 APN 7 126930731 missense probably benign 0.01
IGL03339:Kctd13 APN 7 126945018 missense probably benign
R5322:Kctd13 UTSW 7 126929206 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTTGAACATGGCAGAGGTCTG -3'
(R):5'- GGCTCTTTAGGCCACATCTC -3'

Sequencing Primer
(F):5'- GCTGGAACTCACTCTGTAGAC -3'
(R):5'- GCCACATCTCTCTTCTGTAGTAATAG -3'
Posted On2018-04-27