Incidental Mutation 'R6365:Sema7a'
ID512644
Institutional Source Beutler Lab
Gene Symbol Sema7a
Ensembl Gene ENSMUSG00000038264
Gene Namesema domain, immunoglobulin domain (Ig), and GPI membrane anchor, (semaphorin) 7A
SynonymsCDw108, Semal, 2900057C09Rik, Semaphorin K1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.229) question?
Stock #R6365 (G1)
Quality Score208.009
Status Validated
Chromosome9
Chromosomal Location57940112-57962865 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57954905 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 180 (F180L)
Ref Sequence ENSEMBL: ENSMUSP00000042211 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043059] [ENSMUST00000214314]
Predicted Effect probably benign
Transcript: ENSMUST00000043059
AA Change: F180L

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000042211
Gene: ENSMUSG00000038264
AA Change: F180L

DomainStartEndE-ValueType
signal peptide 1 44 N/A INTRINSIC
Sema 72 472 4.11e-119 SMART
PSI 490 540 7.64e-9 SMART
IG 549 630 3.63e-1 SMART
transmembrane domain 644 663 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000214314
Meta Mutation Damage Score 0.06 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.8%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the semaphorin family of proteins. The encoded preproprotein is proteolytically processed to generate the mature glycosylphosphatidylinositol (GPI)-anchored membrane glycoprotein. The encoded protein is found on activated lymphocytes and erythrocytes and may be involved in immunomodulatory and neuronal processes. The encoded protein carries the John Milton Hagen (JMH) blood group antigens. Mutations in this gene may be associated with reduced bone mineral density (BMD). Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Feb 2016]
PHENOTYPE: The development of the olfactory tract is impaired in homozygous null mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik G T 5: 113,182,644 R1235S probably benign Het
Abca9 T A 11: 110,145,655 I543F possibly damaging Het
Acot6 A G 12: 84,109,412 E378G probably benign Het
Adam30 T C 3: 98,161,034 L61S probably damaging Het
Agap3 T A 5: 24,474,985 L227Q probably benign Het
Ap5m1 T C 14: 49,078,828 I285T probably benign Het
Atp2a2 A G 5: 122,461,916 Y497H probably benign Het
Bace1 C T 9: 45,854,676 Q17* probably null Het
Calcr T C 6: 3,711,455 I189V probably benign Het
Cd48 A T 1: 171,682,164 Q24L probably null Het
Cnga1 T C 5: 72,604,945 I409V probably benign Het
Ctsd G A 7: 142,385,577 T37M probably benign Het
Cyp2c29 T C 19: 39,307,754 S171P probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Drd2 A T 9: 49,406,949 N397I probably damaging Het
Dst A G 1: 34,191,927 E3045G probably damaging Het
Dzip3 T A 16: 48,931,273 R764S probably damaging Het
Exosc10 T C 4: 148,561,105 V114A probably benign Het
Fam234a C A 17: 26,220,455 E32* probably null Het
Fbxw11 C A 11: 32,720,623 D162E possibly damaging Het
Fcho2 A T 13: 98,789,859 M72K probably benign Het
Fech T C 18: 64,458,180 N391S probably benign Het
Foxp2 T C 6: 15,286,685 L58P probably damaging Het
Gdi2 A G 13: 3,565,093 D430G possibly damaging Het
Gm11639 A G 11: 104,924,586 E3247G unknown Het
Grm8 C T 6: 27,363,227 C763Y probably damaging Het
Hibch T A 1: 52,868,937 probably null Het
Hist1h2be C T 13: 23,585,658 R100H probably benign Het
Ifi44l C T 3: 151,761,505 V63I unknown Het
Igf1r G T 7: 68,190,050 A702S probably benign Het
Kctd13 G A 7: 126,930,690 R101Q probably damaging Het
Klhl33 T C 14: 50,891,837 D645G probably benign Het
Lrrc6 A T 15: 66,454,134 S197R probably benign Het
Mylk A G 16: 34,860,591 T74A probably benign Het
Myo1f A G 17: 33,586,116 S453G probably benign Het
Naxe A G 3: 88,057,991 V105A probably damaging Het
Nid2 A G 14: 19,803,133 Y1140C probably damaging Het
Nlrp12 T C 7: 3,239,888 T665A probably benign Het
Olfr630 T A 7: 103,755,195 H130L probably benign Het
Otud7b T G 3: 96,155,250 I602S probably benign Het
Palm2 G T 4: 57,709,675 G207* probably null Het
Papolg T C 11: 23,882,290 D166G probably damaging Het
Pbx4 T G 8: 69,872,207 probably null Het
Pdcd4 T C 19: 53,922,133 probably null Het
Pde2a C T 7: 101,510,363 T800I probably damaging Het
Polk A T 13: 96,484,009 V582E probably damaging Het
Prss40 A G 1: 34,552,517 probably benign Het
Robo4 G T 9: 37,410,712 R597L probably benign Het
Scg2 T A 1: 79,435,300 I529F probably benign Het
Sowahc T C 10: 59,223,527 L495P probably damaging Het
Trf A G 9: 103,222,128 V324A possibly damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Vip C T 10: 5,644,021 R125* probably null Het
Vmn1r159 T A 7: 22,843,401 T69S probably damaging Het
Vmn1r202 A T 13: 22,502,204 F14L probably benign Het
Vmn1r53 T C 6: 90,224,259 N28D probably damaging Het
Vmn2r58 T A 7: 41,864,183 K345N probably benign Het
Zbtb17 G A 4: 141,463,383 G171S probably benign Het
Zbtb8os A T 4: 129,343,152 N120I possibly damaging Het
Zfp959 T A 17: 55,897,785 L274H probably damaging Het
Other mutations in Sema7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00925:Sema7a APN 9 57955838 missense probably damaging 1.00
IGL01967:Sema7a APN 9 57956395 missense probably damaging 1.00
IGL02030:Sema7a APN 9 57955140 missense possibly damaging 0.91
IGL02031:Sema7a APN 9 57955140 missense possibly damaging 0.91
IGL02115:Sema7a APN 9 57960900 missense probably damaging 1.00
IGL02203:Sema7a APN 9 57957606 missense probably benign
IGL02808:Sema7a APN 9 57960348 missense probably benign 0.25
R0531:Sema7a UTSW 9 57960593 missense possibly damaging 0.95
R1603:Sema7a UTSW 9 57960676 missense probably benign 0.18
R1845:Sema7a UTSW 9 57954899 missense possibly damaging 0.65
R4598:Sema7a UTSW 9 57953551 missense probably benign 0.04
R4903:Sema7a UTSW 9 57955095 missense probably benign 0.00
R4954:Sema7a UTSW 9 57956380 missense probably damaging 1.00
R5172:Sema7a UTSW 9 57957678 missense probably benign 0.02
R5514:Sema7a UTSW 9 57955763 missense probably damaging 1.00
R5618:Sema7a UTSW 9 57960283 missense possibly damaging 0.71
R5652:Sema7a UTSW 9 57960659 missense probably damaging 1.00
R5793:Sema7a UTSW 9 57960257 missense probably damaging 0.98
R6736:Sema7a UTSW 9 57960571 missense probably damaging 1.00
R6822:Sema7a UTSW 9 57960336 missense probably damaging 1.00
R6829:Sema7a UTSW 9 57960898 missense probably benign 0.00
R7380:Sema7a UTSW 9 57961564 missense unknown
R7381:Sema7a UTSW 9 57953569 missense probably benign 0.00
R7467:Sema7a UTSW 9 57961422 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGAGAGATTCTGAAGCCGG -3'
(R):5'- CTGCTTCCGGATGGTAGAGTAC -3'

Sequencing Primer
(F):5'- AGAGATTCTGAAGCCGGCTTTACC -3'
(R):5'- CCGGATGGTAGAGTACACTTCATC -3'
Posted On2018-04-27