Incidental Mutation 'R6365:Acot6'
ID512652
Institutional Source Beutler Lab
Gene Symbol Acot6
Ensembl Gene ENSMUSG00000043487
Gene Nameacyl-CoA thioesterase 6
Synonyms4632408A20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6365 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location84100654-84111349 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 84109412 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 378 (E378G)
Ref Sequence ENSEMBL: ENSMUSP00000056131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046340] [ENSMUST00000056822] [ENSMUST00000123491] [ENSMUST00000136159] [ENSMUST00000156138] [ENSMUST00000222921]
Predicted Effect probably benign
Transcript: ENSMUST00000046340
SMART Domains Protein: ENSMUSP00000037076
Gene: ENSMUSG00000042523

DomainStartEndE-ValueType
Pfam:LRR_1 32 52 8.1e-2 PFAM
Pfam:LRR_4 54 96 3.4e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056822
AA Change: E378G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000056131
Gene: ENSMUSG00000043487
AA Change: E378G

DomainStartEndE-ValueType
Pfam:Bile_Hydr_Trans 16 141 1.5e-45 PFAM
Pfam:BAAT_C 203 410 4.1e-80 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123491
SMART Domains Protein: ENSMUSP00000121038
Gene: ENSMUSG00000042523

DomainStartEndE-ValueType
Pfam:LRR_4 93 135 1.4e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136159
SMART Domains Protein: ENSMUSP00000123497
Gene: ENSMUSG00000042523

DomainStartEndE-ValueType
PDB:1DS9|A 1 98 3e-28 PDB
SCOP:d1h6ta2 11 88 5e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143753
Predicted Effect probably benign
Transcript: ENSMUST00000156138
SMART Domains Protein: ENSMUSP00000118584
Gene: ENSMUSG00000042523

DomainStartEndE-ValueType
PDB:1M9L|A 1 50 1e-11 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000222921
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.8%
Validation Efficiency 98% (57/58)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit no detectable phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik G T 5: 113,182,644 R1235S probably benign Het
Abca9 T A 11: 110,145,655 I543F possibly damaging Het
Adam30 T C 3: 98,161,034 L61S probably damaging Het
Agap3 T A 5: 24,474,985 L227Q probably benign Het
Ap5m1 T C 14: 49,078,828 I285T probably benign Het
Atp2a2 A G 5: 122,461,916 Y497H probably benign Het
Bace1 C T 9: 45,854,676 Q17* probably null Het
Calcr T C 6: 3,711,455 I189V probably benign Het
Cd48 A T 1: 171,682,164 Q24L probably null Het
Cnga1 T C 5: 72,604,945 I409V probably benign Het
Ctsd G A 7: 142,385,577 T37M probably benign Het
Cyp2c29 T C 19: 39,307,754 S171P probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Drd2 A T 9: 49,406,949 N397I probably damaging Het
Dst A G 1: 34,191,927 E3045G probably damaging Het
Dzip3 T A 16: 48,931,273 R764S probably damaging Het
Exosc10 T C 4: 148,561,105 V114A probably benign Het
Fam234a C A 17: 26,220,455 E32* probably null Het
Fbxw11 C A 11: 32,720,623 D162E possibly damaging Het
Fcho2 A T 13: 98,789,859 M72K probably benign Het
Fech T C 18: 64,458,180 N391S probably benign Het
Foxp2 T C 6: 15,286,685 L58P probably damaging Het
Gdi2 A G 13: 3,565,093 D430G possibly damaging Het
Gm11639 A G 11: 104,924,586 E3247G unknown Het
Grm8 C T 6: 27,363,227 C763Y probably damaging Het
Hibch T A 1: 52,868,937 probably null Het
Hist1h2be C T 13: 23,585,658 R100H probably benign Het
Ifi44l C T 3: 151,761,505 V63I unknown Het
Igf1r G T 7: 68,190,050 A702S probably benign Het
Kctd13 G A 7: 126,930,690 R101Q probably damaging Het
Klhl33 T C 14: 50,891,837 D645G probably benign Het
Lrrc6 A T 15: 66,454,134 S197R probably benign Het
Mylk A G 16: 34,860,591 T74A probably benign Het
Myo1f A G 17: 33,586,116 S453G probably benign Het
Naxe A G 3: 88,057,991 V105A probably damaging Het
Nid2 A G 14: 19,803,133 Y1140C probably damaging Het
Nlrp12 T C 7: 3,239,888 T665A probably benign Het
Olfr630 T A 7: 103,755,195 H130L probably benign Het
Otud7b T G 3: 96,155,250 I602S probably benign Het
Palm2 G T 4: 57,709,675 G207* probably null Het
Papolg T C 11: 23,882,290 D166G probably damaging Het
Pbx4 T G 8: 69,872,207 probably null Het
Pdcd4 T C 19: 53,922,133 probably null Het
Pde2a C T 7: 101,510,363 T800I probably damaging Het
Polk A T 13: 96,484,009 V582E probably damaging Het
Prss40 A G 1: 34,552,517 probably benign Het
Robo4 G T 9: 37,410,712 R597L probably benign Het
Scg2 T A 1: 79,435,300 I529F probably benign Het
Sema7a T C 9: 57,954,905 F180L probably benign Het
Sowahc T C 10: 59,223,527 L495P probably damaging Het
Trf A G 9: 103,222,128 V324A possibly damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Vip C T 10: 5,644,021 R125* probably null Het
Vmn1r159 T A 7: 22,843,401 T69S probably damaging Het
Vmn1r202 A T 13: 22,502,204 F14L probably benign Het
Vmn1r53 T C 6: 90,224,259 N28D probably damaging Het
Vmn2r58 T A 7: 41,864,183 K345N probably benign Het
Zbtb17 G A 4: 141,463,383 G171S probably benign Het
Zbtb8os A T 4: 129,343,152 N120I possibly damaging Het
Zfp959 T A 17: 55,897,785 L274H probably damaging Het
Other mutations in Acot6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Acot6 APN 12 84109438 missense probably damaging 1.00
IGL00901:Acot6 APN 12 84106476 missense probably benign 0.01
IGL01364:Acot6 APN 12 84101066 missense possibly damaging 0.78
IGL01504:Acot6 APN 12 84109402 missense probably benign 0.05
IGL01707:Acot6 APN 12 84100989 missense probably benign 0.00
R0323:Acot6 UTSW 12 84109179 missense probably benign 0.01
R0531:Acot6 UTSW 12 84101301 missense probably benign 0.00
R1640:Acot6 UTSW 12 84101126 missense probably damaging 1.00
R1934:Acot6 UTSW 12 84106593 missense probably benign 0.18
R2876:Acot6 UTSW 12 84101262 missense possibly damaging 0.87
R4989:Acot6 UTSW 12 84109015 missense probably benign 0.02
R6995:Acot6 UTSW 12 84109375 missense probably damaging 1.00
R7204:Acot6 UTSW 12 84106527 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCACCAGAGTCTTATCCCATTG -3'
(R):5'- GAAGAATCTGTGTGGCATGATTAG -3'

Sequencing Primer
(F):5'- TTATCCCATTGGAAAAGGCCCAGG -3'
(R):5'- ATCTGTGTGGCATGATTAGAACTTTC -3'
Posted On2018-04-27