Incidental Mutation 'R6365:Gdi2'
ID512653
Institutional Source Beutler Lab
Gene Symbol Gdi2
Ensembl Gene ENSMUSG00000021218
Gene Nameguanosine diphosphate (GDP) dissociation inhibitor 2
SynonymsGDIB, Gdi3, GDI beta, GDI-B
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6365 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location3538063-3567871 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3565093 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 430 (D430G)
Ref Sequence ENSEMBL: ENSMUSP00000152454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059515] [ENSMUST00000096069] [ENSMUST00000222365] [ENSMUST00000223396]
Predicted Effect possibly damaging
Transcript: ENSMUST00000059515
AA Change: D394G

PolyPhen 2 Score 0.621 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000062996
Gene: ENSMUSG00000021218
AA Change: D394G

DomainStartEndE-ValueType
Pfam:GDI 1 436 4.6e-239 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000096069
SMART Domains Protein: ENSMUSP00000093774
Gene: ENSMUSG00000033799

DomainStartEndE-ValueType
Pfam:DUF3699 91 167 1.4e-24 PFAM
low complexity region 272 282 N/A INTRINSIC
low complexity region 447 459 N/A INTRINSIC
Pfam:DUF3715 533 695 2.3e-25 PFAM
low complexity region 1156 1168 N/A INTRINSIC
low complexity region 1196 1207 N/A INTRINSIC
low complexity region 1312 1330 N/A INTRINSIC
low complexity region 2012 2021 N/A INTRINSIC
low complexity region 2250 2263 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000221581
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221629
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221875
Predicted Effect probably benign
Transcript: ENSMUST00000222365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222615
Predicted Effect probably benign
Transcript: ENSMUST00000222909
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223046
Predicted Effect possibly damaging
Transcript: ENSMUST00000223396
AA Change: D430G

PolyPhen 2 Score 0.824 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.416 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.8%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] GDP dissociation inhibitors are proteins that regulate the GDP-GTP exchange reaction of members of the rab family, small GTP-binding proteins of the ras superfamily, that are involved in vesicular trafficking of molecules between cellular organelles. GDIs slow the rate of dissociation of GDP from rab proteins and release GDP from membrane-bound rabs. GDI2 is ubiquitously expressed. The GDI2 gene contains many repetitive elements indicating that it may be prone to inversion/deletion rearrangements. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik G T 5: 113,182,644 R1235S probably benign Het
Abca9 T A 11: 110,145,655 I543F possibly damaging Het
Acot6 A G 12: 84,109,412 E378G probably benign Het
Adam30 T C 3: 98,161,034 L61S probably damaging Het
Agap3 T A 5: 24,474,985 L227Q probably benign Het
Ap5m1 T C 14: 49,078,828 I285T probably benign Het
Atp2a2 A G 5: 122,461,916 Y497H probably benign Het
Bace1 C T 9: 45,854,676 Q17* probably null Het
Calcr T C 6: 3,711,455 I189V probably benign Het
Cd48 A T 1: 171,682,164 Q24L probably null Het
Cnga1 T C 5: 72,604,945 I409V probably benign Het
Ctsd G A 7: 142,385,577 T37M probably benign Het
Cyp2c29 T C 19: 39,307,754 S171P probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Drd2 A T 9: 49,406,949 N397I probably damaging Het
Dst A G 1: 34,191,927 E3045G probably damaging Het
Dzip3 T A 16: 48,931,273 R764S probably damaging Het
Exosc10 T C 4: 148,561,105 V114A probably benign Het
Fam234a C A 17: 26,220,455 E32* probably null Het
Fbxw11 C A 11: 32,720,623 D162E possibly damaging Het
Fcho2 A T 13: 98,789,859 M72K probably benign Het
Fech T C 18: 64,458,180 N391S probably benign Het
Foxp2 T C 6: 15,286,685 L58P probably damaging Het
Gm11639 A G 11: 104,924,586 E3247G unknown Het
Grm8 C T 6: 27,363,227 C763Y probably damaging Het
Hibch T A 1: 52,868,937 probably null Het
Hist1h2be C T 13: 23,585,658 R100H probably benign Het
Ifi44l C T 3: 151,761,505 V63I unknown Het
Igf1r G T 7: 68,190,050 A702S probably benign Het
Kctd13 G A 7: 126,930,690 R101Q probably damaging Het
Klhl33 T C 14: 50,891,837 D645G probably benign Het
Lrrc6 A T 15: 66,454,134 S197R probably benign Het
Mylk A G 16: 34,860,591 T74A probably benign Het
Myo1f A G 17: 33,586,116 S453G probably benign Het
Naxe A G 3: 88,057,991 V105A probably damaging Het
Nid2 A G 14: 19,803,133 Y1140C probably damaging Het
Nlrp12 T C 7: 3,239,888 T665A probably benign Het
Olfr630 T A 7: 103,755,195 H130L probably benign Het
Otud7b T G 3: 96,155,250 I602S probably benign Het
Palm2 G T 4: 57,709,675 G207* probably null Het
Papolg T C 11: 23,882,290 D166G probably damaging Het
Pbx4 T G 8: 69,872,207 probably null Het
Pdcd4 T C 19: 53,922,133 probably null Het
Pde2a C T 7: 101,510,363 T800I probably damaging Het
Polk A T 13: 96,484,009 V582E probably damaging Het
Prss40 A G 1: 34,552,517 probably benign Het
Robo4 G T 9: 37,410,712 R597L probably benign Het
Scg2 T A 1: 79,435,300 I529F probably benign Het
Sema7a T C 9: 57,954,905 F180L probably benign Het
Sowahc T C 10: 59,223,527 L495P probably damaging Het
Trf A G 9: 103,222,128 V324A possibly damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Vip C T 10: 5,644,021 R125* probably null Het
Vmn1r159 T A 7: 22,843,401 T69S probably damaging Het
Vmn1r202 A T 13: 22,502,204 F14L probably benign Het
Vmn1r53 T C 6: 90,224,259 N28D probably damaging Het
Vmn2r58 T A 7: 41,864,183 K345N probably benign Het
Zbtb17 G A 4: 141,463,383 G171S probably benign Het
Zbtb8os A T 4: 129,343,152 N120I possibly damaging Het
Zfp959 T A 17: 55,897,785 L274H probably damaging Het
Other mutations in Gdi2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Gdi2 APN 13 3556467 missense probably benign 0.04
IGL01135:Gdi2 APN 13 3548855 splice site probably benign
IGL01402:Gdi2 APN 13 3564611 missense probably benign 0.24
IGL01404:Gdi2 APN 13 3564611 missense probably benign 0.24
IGL02100:Gdi2 APN 13 3556373 missense probably benign 0.03
IGL02305:Gdi2 APN 13 3556428 missense probably damaging 1.00
IGL02545:Gdi2 APN 13 3557009 missense probably damaging 1.00
IGL02561:Gdi2 APN 13 3548954 missense possibly damaging 0.94
IGL02939:Gdi2 APN 13 3564623 missense probably benign 0.21
E0354:Gdi2 UTSW 13 3561939 unclassified probably null
R1612:Gdi2 UTSW 13 3560051 missense probably benign 0.00
R1775:Gdi2 UTSW 13 3560018 missense possibly damaging 0.71
R1803:Gdi2 UTSW 13 3564547 nonsense probably null
R2254:Gdi2 UTSW 13 3554400 splice site probably null
R2426:Gdi2 UTSW 13 3562034 missense probably benign 0.17
R4081:Gdi2 UTSW 13 3548866 missense probably benign 0.10
R7130:Gdi2 UTSW 13 3548891 missense probably benign 0.12
R7268:Gdi2 UTSW 13 3556363 nonsense probably null
R7349:Gdi2 UTSW 13 3556395 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- ACCTCTTTGTACCTAAAGATTTGGG -3'
(R):5'- AGGAGCATTCACTGGTATAGCAC -3'

Sequencing Primer
(F):5'- CCTAAAGATTTGGGAACAGATAGTC -3'
(R):5'- GAGCATTCACTGGTATAGCACTCTTC -3'
Posted On2018-04-27