Incidental Mutation 'R6365:Klhl33'
ID512660
Institutional Source Beutler Lab
Gene Symbol Klhl33
Ensembl Gene ENSMUSG00000090799
Gene Namekelch-like 33
SynonymsEG546611
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R6365 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location50888582-50897507 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50891837 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 645 (D645G)
Ref Sequence ENSEMBL: ENSMUSP00000154785 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164415] [ENSMUST00000170855] [ENSMUST00000227271]
Predicted Effect probably benign
Transcript: ENSMUST00000164415
AA Change: D385G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129810
Gene: ENSMUSG00000090799
AA Change: D385G

DomainStartEndE-ValueType
Pfam:BTB 1 70 5.7e-6 PFAM
BACK 75 176 3.59e-21 SMART
Kelch 273 322 5.26e-3 SMART
Kelch 323 369 7.83e-11 SMART
Kelch 370 418 1.46e-1 SMART
Kelch 419 465 2.84e-8 SMART
Kelch 466 514 6.08e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170855
SMART Domains Protein: ENSMUSP00000131456
Gene: ENSMUSG00000090799

DomainStartEndE-ValueType
SCOP:d1buoa_ 83 129 2e-3 SMART
Blast:BTB 109 170 2e-18 BLAST
SCOP:d1jkjb2 142 198 2e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226765
Predicted Effect probably benign
Transcript: ENSMUST00000227271
AA Change: D645G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0628 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.8%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik G T 5: 113,182,644 R1235S probably benign Het
Abca9 T A 11: 110,145,655 I543F possibly damaging Het
Acot6 A G 12: 84,109,412 E378G probably benign Het
Adam30 T C 3: 98,161,034 L61S probably damaging Het
Agap3 T A 5: 24,474,985 L227Q probably benign Het
Ap5m1 T C 14: 49,078,828 I285T probably benign Het
Atp2a2 A G 5: 122,461,916 Y497H probably benign Het
Bace1 C T 9: 45,854,676 Q17* probably null Het
Calcr T C 6: 3,711,455 I189V probably benign Het
Cd48 A T 1: 171,682,164 Q24L probably null Het
Cnga1 T C 5: 72,604,945 I409V probably benign Het
Ctsd G A 7: 142,385,577 T37M probably benign Het
Cyp2c29 T C 19: 39,307,754 S171P probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Drd2 A T 9: 49,406,949 N397I probably damaging Het
Dst A G 1: 34,191,927 E3045G probably damaging Het
Dzip3 T A 16: 48,931,273 R764S probably damaging Het
Exosc10 T C 4: 148,561,105 V114A probably benign Het
Fam234a C A 17: 26,220,455 E32* probably null Het
Fbxw11 C A 11: 32,720,623 D162E possibly damaging Het
Fcho2 A T 13: 98,789,859 M72K probably benign Het
Fech T C 18: 64,458,180 N391S probably benign Het
Foxp2 T C 6: 15,286,685 L58P probably damaging Het
Gdi2 A G 13: 3,565,093 D430G possibly damaging Het
Gm11639 A G 11: 104,924,586 E3247G unknown Het
Grm8 C T 6: 27,363,227 C763Y probably damaging Het
Hibch T A 1: 52,868,937 probably null Het
Hist1h2be C T 13: 23,585,658 R100H probably benign Het
Ifi44l C T 3: 151,761,505 V63I unknown Het
Igf1r G T 7: 68,190,050 A702S probably benign Het
Kctd13 G A 7: 126,930,690 R101Q probably damaging Het
Lrrc6 A T 15: 66,454,134 S197R probably benign Het
Mylk A G 16: 34,860,591 T74A probably benign Het
Myo1f A G 17: 33,586,116 S453G probably benign Het
Naxe A G 3: 88,057,991 V105A probably damaging Het
Nid2 A G 14: 19,803,133 Y1140C probably damaging Het
Nlrp12 T C 7: 3,239,888 T665A probably benign Het
Olfr630 T A 7: 103,755,195 H130L probably benign Het
Otud7b T G 3: 96,155,250 I602S probably benign Het
Palm2 G T 4: 57,709,675 G207* probably null Het
Papolg T C 11: 23,882,290 D166G probably damaging Het
Pbx4 T G 8: 69,872,207 probably null Het
Pdcd4 T C 19: 53,922,133 probably null Het
Pde2a C T 7: 101,510,363 T800I probably damaging Het
Polk A T 13: 96,484,009 V582E probably damaging Het
Prss40 A G 1: 34,552,517 probably benign Het
Robo4 G T 9: 37,410,712 R597L probably benign Het
Scg2 T A 1: 79,435,300 I529F probably benign Het
Sema7a T C 9: 57,954,905 F180L probably benign Het
Sowahc T C 10: 59,223,527 L495P probably damaging Het
Trf A G 9: 103,222,128 V324A possibly damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Vip C T 10: 5,644,021 R125* probably null Het
Vmn1r159 T A 7: 22,843,401 T69S probably damaging Het
Vmn1r202 A T 13: 22,502,204 F14L probably benign Het
Vmn1r53 T C 6: 90,224,259 N28D probably damaging Het
Vmn2r58 T A 7: 41,864,183 K345N probably benign Het
Zbtb17 G A 4: 141,463,383 G171S probably benign Het
Zbtb8os A T 4: 129,343,152 N120I possibly damaging Het
Zfp959 T A 17: 55,897,785 L274H probably damaging Het
Other mutations in Klhl33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01561:Klhl33 APN 14 50891431 missense probably benign 0.03
IGL01965:Klhl33 APN 14 50891730 missense probably damaging 1.00
IGL02804:Klhl33 APN 14 50892954 missense probably damaging 1.00
IGL02830:Klhl33 APN 14 50891757 missense probably damaging 1.00
R0309:Klhl33 UTSW 14 50891411 missense probably damaging 0.97
R0520:Klhl33 UTSW 14 50891683 missense probably damaging 1.00
R0671:Klhl33 UTSW 14 50892394 missense probably damaging 0.99
R0894:Klhl33 UTSW 14 50892126 missense probably damaging 0.99
R0989:Klhl33 UTSW 14 50891822 missense probably damaging 1.00
R1681:Klhl33 UTSW 14 50893077 missense probably benign 0.28
R1795:Klhl33 UTSW 14 50892126 missense probably damaging 0.99
R2088:Klhl33 UTSW 14 50892773 nonsense probably null
R3114:Klhl33 UTSW 14 50891515 missense possibly damaging 0.61
R5650:Klhl33 UTSW 14 50891828 missense probably benign 0.08
R5851:Klhl33 UTSW 14 50892878 missense probably damaging 1.00
R5995:Klhl33 UTSW 14 50892651 missense possibly damaging 0.83
R6434:Klhl33 UTSW 14 50893107 missense probably damaging 1.00
R6803:Klhl33 UTSW 14 50896735 missense probably damaging 0.99
R6881:Klhl33 UTSW 14 50891472 missense probably benign 0.12
R6932:Klhl33 UTSW 14 50891916 missense probably benign 0.03
R6953:Klhl33 UTSW 14 50891516 missense possibly damaging 0.79
R6998:Klhl33 UTSW 14 50893021 missense probably benign 0.00
R7545:Klhl33 UTSW 14 50893174 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGCTCTTTGGTTCATAGGC -3'
(R):5'- AACCAGCAGAAACTAGGTTTGG -3'

Sequencing Primer
(F):5'- CTTCAAAGCTTAGTAGGTCCCCAGTG -3'
(R):5'- AATCTTAGCGCTGCTCAGG -3'
Posted On2018-04-27