Incidental Mutation 'R6365:Fech'
ID512668
Institutional Source Beutler Lab
Gene Symbol Fech
Ensembl Gene ENSMUSG00000024588
Gene Nameferrochelatase
Synonymsfch, Fcl
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6365 (G1)
Quality Score104.008
Status Validated
Chromosome18
Chromosomal Location64456550-64489066 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 64458180 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 391 (N391S)
Ref Sequence ENSEMBL: ENSMUSP00000025484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025484]
Predicted Effect probably benign
Transcript: ENSMUST00000025484
AA Change: N391S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000025484
Gene: ENSMUSG00000024588
AA Change: N391S

DomainStartEndE-ValueType
low complexity region 1 20 N/A INTRINSIC
Pfam:Ferrochelatase 67 388 5.9e-115 PFAM
Meta Mutation Damage Score 0.148 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.8%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is localized to the mitochondrion, where it catalyzes the insertion of the ferrous form of iron into protoporphyrin IX in the heme synthesis pathway. Mutations in this gene are associated with erythropoietic protoporphyria. Two transcript variants encoding different isoforms have been found for this gene. A pseudogene of this gene is found on chromosome 3.[provided by RefSeq, May 2010]
PHENOTYPE: Homozygotes for an ENU-induced mutation exhibit hemolytic anemia, photosensitivity, cholestasis, and hepatic dysfunction. Homozygotes for a targeted null mutation die prior to embryonic day 3.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik G T 5: 113,182,644 R1235S probably benign Het
Abca9 T A 11: 110,145,655 I543F possibly damaging Het
Acot6 A G 12: 84,109,412 E378G probably benign Het
Adam30 T C 3: 98,161,034 L61S probably damaging Het
Agap3 T A 5: 24,474,985 L227Q probably benign Het
Ap5m1 T C 14: 49,078,828 I285T probably benign Het
Atp2a2 A G 5: 122,461,916 Y497H probably benign Het
Bace1 C T 9: 45,854,676 Q17* probably null Het
Calcr T C 6: 3,711,455 I189V probably benign Het
Cd48 A T 1: 171,682,164 Q24L probably null Het
Cnga1 T C 5: 72,604,945 I409V probably benign Het
Ctsd G A 7: 142,385,577 T37M probably benign Het
Cyp2c29 T C 19: 39,307,754 S171P probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Drd2 A T 9: 49,406,949 N397I probably damaging Het
Dst A G 1: 34,191,927 E3045G probably damaging Het
Dzip3 T A 16: 48,931,273 R764S probably damaging Het
Exosc10 T C 4: 148,561,105 V114A probably benign Het
Fam234a C A 17: 26,220,455 E32* probably null Het
Fbxw11 C A 11: 32,720,623 D162E possibly damaging Het
Fcho2 A T 13: 98,789,859 M72K probably benign Het
Foxp2 T C 6: 15,286,685 L58P probably damaging Het
Gdi2 A G 13: 3,565,093 D430G possibly damaging Het
Gm11639 A G 11: 104,924,586 E3247G unknown Het
Grm8 C T 6: 27,363,227 C763Y probably damaging Het
Hibch T A 1: 52,868,937 probably null Het
Hist1h2be C T 13: 23,585,658 R100H probably benign Het
Ifi44l C T 3: 151,761,505 V63I unknown Het
Igf1r G T 7: 68,190,050 A702S probably benign Het
Kctd13 G A 7: 126,930,690 R101Q probably damaging Het
Klhl33 T C 14: 50,891,837 D645G probably benign Het
Lrrc6 A T 15: 66,454,134 S197R probably benign Het
Mylk A G 16: 34,860,591 T74A probably benign Het
Myo1f A G 17: 33,586,116 S453G probably benign Het
Naxe A G 3: 88,057,991 V105A probably damaging Het
Nid2 A G 14: 19,803,133 Y1140C probably damaging Het
Nlrp12 T C 7: 3,239,888 T665A probably benign Het
Olfr630 T A 7: 103,755,195 H130L probably benign Het
Otud7b T G 3: 96,155,250 I602S probably benign Het
Palm2 G T 4: 57,709,675 G207* probably null Het
Papolg T C 11: 23,882,290 D166G probably damaging Het
Pbx4 T G 8: 69,872,207 probably null Het
Pdcd4 T C 19: 53,922,133 probably null Het
Pde2a C T 7: 101,510,363 T800I probably damaging Het
Polk A T 13: 96,484,009 V582E probably damaging Het
Prss40 A G 1: 34,552,517 probably benign Het
Robo4 G T 9: 37,410,712 R597L probably benign Het
Scg2 T A 1: 79,435,300 I529F probably benign Het
Sema7a T C 9: 57,954,905 F180L probably benign Het
Sowahc T C 10: 59,223,527 L495P probably damaging Het
Trf A G 9: 103,222,128 V324A possibly damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Vip C T 10: 5,644,021 R125* probably null Het
Vmn1r159 T A 7: 22,843,401 T69S probably damaging Het
Vmn1r202 A T 13: 22,502,204 F14L probably benign Het
Vmn1r53 T C 6: 90,224,259 N28D probably damaging Het
Vmn2r58 T A 7: 41,864,183 K345N probably benign Het
Zbtb17 G A 4: 141,463,383 G171S probably benign Het
Zbtb8os A T 4: 129,343,152 N120I possibly damaging Het
Zfp959 T A 17: 55,897,785 L274H probably damaging Het
Other mutations in Fech
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0652:Fech UTSW 18 64458169 missense probably damaging 1.00
R1468:Fech UTSW 18 64470673 splice site probably benign
R1619:Fech UTSW 18 64462118 missense probably damaging 1.00
R1652:Fech UTSW 18 64458198 missense probably benign
R2020:Fech UTSW 18 64478727 missense probably damaging 0.99
R2082:Fech UTSW 18 64458189 missense probably damaging 0.99
R5334:Fech UTSW 18 64464120 missense probably damaging 1.00
R5930:Fech UTSW 18 64478649 critical splice donor site probably null
R6349:Fech UTSW 18 64470785 nonsense probably null
R7412:Fech UTSW 18 64458184 missense probably benign 0.00
R7492:Fech UTSW 18 64467771 nonsense probably null
R7539:Fech UTSW 18 64483494 intron probably null
R7545:Fech UTSW 18 64464114 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTTGTGCCCAGACAAACG -3'
(R):5'- CGTCCTAAGCTGATGATGTCCAG -3'

Sequencing Primer
(F):5'- AGACAAACGTGGCTTCTGTC -3'
(R):5'- TCCTAAGCTGATGATGTCCAGAATGG -3'
Posted On2018-04-27