Incidental Mutation 'R6367:Dip2b'
ID512760
Institutional Source Beutler Lab
Gene Symbol Dip2b
Ensembl Gene ENSMUSG00000023026
Gene Namedisco interacting protein 2 homolog B
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.477) question?
Stock #R6367 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location100038664-100219473 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 100115914 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 57 (Q57L)
Ref Sequence ENSEMBL: ENSMUSP00000097777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100203]
Predicted Effect possibly damaging
Transcript: ENSMUST00000100203
AA Change: Q57L

PolyPhen 2 Score 0.503 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000097777
Gene: ENSMUSG00000023026
AA Change: Q57L

DomainStartEndE-ValueType
DMAP_binding 12 130 1e-42 SMART
low complexity region 152 168 N/A INTRINSIC
low complexity region 181 192 N/A INTRINSIC
Pfam:AMP-binding 341 817 2e-26 PFAM
Pfam:AMP-binding 993 1468 1.8e-64 PFAM
low complexity region 1532 1544 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 protein family. The encoded protein contains a binding site for the transcriptional regulator DNA methyltransferase 1 associated protein 1 as well as AMP-binding sites. The presence of these sites suggests that the encoded protein may participate in DNA methylation. This gene is located near a folate-sensitive fragile site, and CGG-repeat expansion in the promoter of this gene which affects transcription has been detected in individuals containing this fragile site on chromosome 12. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,216,248 N54D possibly damaging Het
Abca4 A C 3: 122,103,580 Q636P probably damaging Het
Agk T C 6: 40,386,941 F285S probably benign Het
Als2 C A 1: 59,199,140 V678L probably benign Het
Arhgap17 T C 7: 123,308,363 *231W probably null Het
Atp11b A G 3: 35,784,537 T89A probably damaging Het
Axl A T 7: 25,787,433 C50S probably damaging Het
Cachd1 A G 4: 101,002,970 D1246G probably damaging Het
Dnah14 A G 1: 181,755,386 probably null Het
Enpep G T 3: 129,332,081 T134N possibly damaging Het
Ets1 C T 9: 32,733,960 Q168* probably null Het
Fanci T C 7: 79,426,195 C529R probably damaging Het
Fbxw28 A G 9: 109,339,531 probably null Het
Gucy2c C T 6: 136,709,778 E796K probably damaging Het
Igsf9b G A 9: 27,309,525 W62* probably null Het
Kcng1 C A 2: 168,262,652 V425L probably damaging Het
Kndc1 T C 7: 139,913,506 S463P probably damaging Het
Lrba G C 3: 86,368,562 A1746P probably benign Het
Mgat4c G T 10: 102,385,154 probably null Het
Nckap1l G A 15: 103,475,722 M582I probably benign Het
Oacyl G T 18: 65,725,444 R207L probably damaging Het
Olfr1148 T C 2: 87,833,593 C185R probably damaging Het
Olfr1263 A G 2: 90,015,016 I29V probably benign Het
Olfr164 C T 16: 19,286,072 V224M probably damaging Het
Olfr561 C A 7: 102,774,829 Q102K possibly damaging Het
Pacsin2 C T 15: 83,381,832 A55T probably benign Het
Plekhm2 T C 4: 141,639,705 D208G probably damaging Het
Ptpru T C 4: 131,774,352 D1181G probably benign Het
Safb A G 17: 56,593,845 probably benign Het
Scp2 T A 4: 108,112,250 Y35F probably damaging Het
Secisbp2 A G 13: 51,682,141 Y757C probably damaging Het
Sp110 C T 1: 85,594,292 V97M probably benign Het
Ssx2ip A G 3: 146,419,166 Y82C probably benign Het
Svopl A T 6: 38,019,679 W288R possibly damaging Het
Tdg T C 10: 82,647,988 Y345H possibly damaging Het
Tmem109 A G 19: 10,874,363 F53S possibly damaging Het
Tpsab1 G T 17: 25,343,474 T293N probably damaging Het
Trpm8 A G 1: 88,359,683 D796G probably damaging Het
Tuba1c T C 15: 99,037,453 I265T probably damaging Het
Unc80 T C 1: 66,672,766 V2749A probably benign Het
Utrn A G 10: 12,747,975 L173P probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wbp2 G T 11: 116,083,915 T31N probably benign Het
Wdr1 G T 5: 38,545,846 A129D possibly damaging Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Other mutations in Dip2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Dip2b APN 15 100174501 missense probably damaging 1.00
IGL01716:Dip2b APN 15 100209636 missense probably benign 0.00
IGL01893:Dip2b APN 15 100171220 splice site probably benign
IGL01915:Dip2b APN 15 100178511 missense probably damaging 1.00
IGL02125:Dip2b APN 15 100186250 missense possibly damaging 0.60
IGL02200:Dip2b APN 15 100151202 missense possibly damaging 0.93
IGL02506:Dip2b APN 15 100157281 missense probably damaging 1.00
IGL02571:Dip2b APN 15 100157885 missense possibly damaging 0.93
IGL02706:Dip2b APN 15 100215311 missense probably damaging 0.98
IGL02983:Dip2b APN 15 100132022 missense possibly damaging 0.81
IGL03120:Dip2b APN 15 100203127 splice site probably benign
IGL03181:Dip2b APN 15 100215207 missense probably damaging 0.98
IGL03229:Dip2b APN 15 100207838 splice site probably benign
IGL03399:Dip2b APN 15 100175327 missense possibly damaging 0.63
PIT4131001:Dip2b UTSW 15 100202352 missense probably damaging 1.00
R0009:Dip2b UTSW 15 100169312 missense probably damaging 1.00
R0058:Dip2b UTSW 15 100215240 missense probably benign 0.03
R0058:Dip2b UTSW 15 100215240 missense probably benign 0.03
R0092:Dip2b UTSW 15 100202265 missense probably damaging 1.00
R0201:Dip2b UTSW 15 100186147 missense probably damaging 0.98
R0359:Dip2b UTSW 15 100211993 missense probably damaging 0.98
R0390:Dip2b UTSW 15 100193913 missense probably damaging 0.99
R0564:Dip2b UTSW 15 100162719 nonsense probably null
R0730:Dip2b UTSW 15 100171651 missense probably damaging 1.00
R1144:Dip2b UTSW 15 100154250 missense probably benign 0.11
R1200:Dip2b UTSW 15 100209745 missense probably benign 0.00
R1506:Dip2b UTSW 15 100183113 missense probably damaging 1.00
R1750:Dip2b UTSW 15 100178466 missense probably benign
R1760:Dip2b UTSW 15 100212029 missense probably damaging 1.00
R1773:Dip2b UTSW 15 100193961 missense probably benign 0.00
R1812:Dip2b UTSW 15 100198938 unclassified probably null
R2264:Dip2b UTSW 15 100203216 missense probably benign 0.05
R3105:Dip2b UTSW 15 100142137 nonsense probably null
R4029:Dip2b UTSW 15 100186172 missense probably damaging 1.00
R4030:Dip2b UTSW 15 100186172 missense probably damaging 1.00
R4296:Dip2b UTSW 15 100181336 missense probably benign
R4392:Dip2b UTSW 15 100162036 missense probably damaging 1.00
R4480:Dip2b UTSW 15 100186301 missense probably damaging 0.99
R4564:Dip2b UTSW 15 100157258 nonsense probably null
R4605:Dip2b UTSW 15 100209636 missense probably benign 0.00
R4606:Dip2b UTSW 15 100215329 missense possibly damaging 0.91
R4634:Dip2b UTSW 15 100160491 missense probably damaging 1.00
R4667:Dip2b UTSW 15 100151360 missense probably benign 0.01
R4739:Dip2b UTSW 15 100207777 missense probably damaging 0.98
R4826:Dip2b UTSW 15 100169281 missense probably damaging 0.99
R4870:Dip2b UTSW 15 100195784 unclassified probably null
R4877:Dip2b UTSW 15 100160529 missense possibly damaging 0.49
R4932:Dip2b UTSW 15 100171722 missense probably damaging 1.00
R5009:Dip2b UTSW 15 100195784 unclassified probably null
R5169:Dip2b UTSW 15 100205113 missense probably damaging 1.00
R5216:Dip2b UTSW 15 100211986 missense probably damaging 1.00
R5218:Dip2b UTSW 15 100154296 missense probably benign 0.00
R5274:Dip2b UTSW 15 100212104 missense possibly damaging 0.54
R5370:Dip2b UTSW 15 100211986 missense probably damaging 1.00
R5420:Dip2b UTSW 15 100205173 intron probably benign
R5447:Dip2b UTSW 15 100211986 missense probably damaging 1.00
R5670:Dip2b UTSW 15 100190104 missense possibly damaging 0.80
R5768:Dip2b UTSW 15 100157945 missense probably benign 0.32
R5908:Dip2b UTSW 15 100151184 missense possibly damaging 0.93
R5957:Dip2b UTSW 15 100209694 missense probably benign 0.03
R5987:Dip2b UTSW 15 100190079 missense probably damaging 1.00
R6260:Dip2b UTSW 15 100162702 missense probably benign 0.05
R6325:Dip2b UTSW 15 100154282 missense probably benign 0.00
R6391:Dip2b UTSW 15 100151276 missense probably damaging 1.00
R6422:Dip2b UTSW 15 100199011 missense probably damaging 0.98
R6818:Dip2b UTSW 15 100193954 missense probably benign 0.09
R6922:Dip2b UTSW 15 100193843 missense probably benign 0.25
X0064:Dip2b UTSW 15 100115850 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGGTACTTCTCTAGCATGC -3'
(R):5'- ATTCTGTCACTGAACCGTCTCAG -3'

Sequencing Primer
(F):5'- TTAGGGGACATCACACAG -3'
(R):5'- CACCCGAGGTCTATGCAAATGG -3'
Posted On2018-04-27