Incidental Mutation 'R6368:Arid1b'
ID512819
Institutional Source Beutler Lab
Gene Symbol Arid1b
Ensembl Gene ENSMUSG00000069729
Gene NameAT rich interactive domain 1B (SWI-like)
SynonymsB230217J03Rik, 9330189K18Rik
Accession Numbers

Ncbi RefSeq: NM_001085355.1; MGI:1926129

Is this an essential gene? Possibly essential (E-score: 0.528) question?
Stock #R6368 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location4994332-5347656 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 5332533 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 1297 (N1297K)
Ref Sequence ENSEMBL: ENSMUSP00000090398 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092723] [ENSMUST00000115797] [ENSMUST00000115799] [ENSMUST00000232180]
Predicted Effect possibly damaging
Transcript: ENSMUST00000092723
AA Change: N1297K

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000090398
Gene: ENSMUSG00000069729
AA Change: N1297K

DomainStartEndE-ValueType
low complexity region 2 51 N/A INTRINSIC
low complexity region 69 132 N/A INTRINSIC
low complexity region 139 150 N/A INTRINSIC
low complexity region 201 224 N/A INTRINSIC
low complexity region 232 247 N/A INTRINSIC
low complexity region 257 276 N/A INTRINSIC
low complexity region 301 371 N/A INTRINSIC
low complexity region 379 407 N/A INTRINSIC
low complexity region 438 476 N/A INTRINSIC
low complexity region 485 499 N/A INTRINSIC
low complexity region 538 558 N/A INTRINSIC
low complexity region 574 591 N/A INTRINSIC
low complexity region 596 611 N/A INTRINSIC
low complexity region 615 640 N/A INTRINSIC
low complexity region 691 707 N/A INTRINSIC
low complexity region 719 740 N/A INTRINSIC
low complexity region 743 773 N/A INTRINSIC
low complexity region 805 816 N/A INTRINSIC
low complexity region 912 930 N/A INTRINSIC
low complexity region 936 952 N/A INTRINSIC
low complexity region 974 985 N/A INTRINSIC
low complexity region 1036 1045 N/A INTRINSIC
ARID 1057 1147 9.9e-33 SMART
BRIGHT 1061 1152 7.62e-41 SMART
low complexity region 1166 1177 N/A INTRINSIC
low complexity region 1257 1268 N/A INTRINSIC
low complexity region 1336 1364 N/A INTRINSIC
low complexity region 1426 1456 N/A INTRINSIC
low complexity region 1473 1486 N/A INTRINSIC
low complexity region 1579 1595 N/A INTRINSIC
coiled coil region 1724 1745 N/A INTRINSIC
low complexity region 1835 1843 N/A INTRINSIC
Pfam:DUF3518 1933 2189 1.5e-152 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115797
AA Change: N1298K

PolyPhen 2 Score 0.421 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000111463
Gene: ENSMUSG00000069729
AA Change: N1298K

DomainStartEndE-ValueType
low complexity region 17 80 N/A INTRINSIC
low complexity region 87 98 N/A INTRINSIC
low complexity region 149 172 N/A INTRINSIC
low complexity region 180 195 N/A INTRINSIC
low complexity region 205 224 N/A INTRINSIC
low complexity region 249 319 N/A INTRINSIC
low complexity region 327 355 N/A INTRINSIC
low complexity region 386 424 N/A INTRINSIC
low complexity region 433 447 N/A INTRINSIC
low complexity region 486 506 N/A INTRINSIC
low complexity region 522 539 N/A INTRINSIC
low complexity region 544 559 N/A INTRINSIC
low complexity region 563 588 N/A INTRINSIC
low complexity region 639 655 N/A INTRINSIC
low complexity region 667 688 N/A INTRINSIC
low complexity region 691 721 N/A INTRINSIC
low complexity region 753 764 N/A INTRINSIC
low complexity region 860 878 N/A INTRINSIC
low complexity region 884 900 N/A INTRINSIC
low complexity region 922 933 N/A INTRINSIC
Blast:ARID 981 1028 1e-8 BLAST
low complexity region 1029 1054 N/A INTRINSIC
ARID 1058 1148 9.9e-33 SMART
BRIGHT 1062 1153 7.62e-41 SMART
low complexity region 1167 1178 N/A INTRINSIC
low complexity region 1258 1269 N/A INTRINSIC
low complexity region 1337 1365 N/A INTRINSIC
low complexity region 1427 1457 N/A INTRINSIC
low complexity region 1474 1487 N/A INTRINSIC
low complexity region 1580 1596 N/A INTRINSIC
coiled coil region 1725 1746 N/A INTRINSIC
low complexity region 1836 1844 N/A INTRINSIC
Pfam:DUF3518 1935 2190 6.3e-121 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115799
AA Change: N816K

PolyPhen 2 Score 0.320 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000111465
Gene: ENSMUSG00000069729
AA Change: N816K

DomainStartEndE-ValueType
low complexity region 34 54 N/A INTRINSIC
low complexity region 70 87 N/A INTRINSIC
low complexity region 92 107 N/A INTRINSIC
low complexity region 111 136 N/A INTRINSIC
low complexity region 187 203 N/A INTRINSIC
low complexity region 215 236 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 378 396 N/A INTRINSIC
low complexity region 402 418 N/A INTRINSIC
low complexity region 440 451 N/A INTRINSIC
Blast:ARID 499 546 1e-8 BLAST
low complexity region 547 572 N/A INTRINSIC
ARID 576 666 9.9e-33 SMART
BRIGHT 580 671 7.62e-41 SMART
low complexity region 685 696 N/A INTRINSIC
low complexity region 776 787 N/A INTRINSIC
low complexity region 855 883 N/A INTRINSIC
low complexity region 945 975 N/A INTRINSIC
low complexity region 992 1005 N/A INTRINSIC
low complexity region 1098 1114 N/A INTRINSIC
coiled coil region 1243 1264 N/A INTRINSIC
low complexity region 1354 1362 N/A INTRINSIC
Pfam:DUF3518 1452 1708 1.1e-152 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000232180
AA Change: N1350K

PolyPhen 2 Score 0.375 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes an AT-rich DNA interacting domain-containing protein. The encoded protein is a component of the SWI/SNF chromatin remodeling complex and may play a role in cell-cycle activation. The protein encoded by this locus is similar to AT-rich interactive domain-containing protein 1A. These two proteins function as alternative, mutually exclusive ARID-subunits of the SWI/SNF complex. The associated complexes play opposing roles. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2016]
Allele List at MGI

All alleles(61) : Targeted(2) Gene trapped(59)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik C A 9: 55,990,132 E272D possibly damaging Het
Abi2 A G 1: 60,453,651 T158A possibly damaging Het
Acacb T C 5: 114,216,823 S1221P probably damaging Het
Agbl1 A G 7: 76,419,830 D370G probably benign Het
Apeh A G 9: 108,087,243 I487T probably damaging Het
Ascc3 G A 10: 50,699,985 G779S probably damaging Het
Atp7b A C 8: 22,020,755 probably null Het
Bsn C T 9: 108,111,314 probably benign Het
Caps2 C T 10: 112,194,968 Q268* probably null Het
Cnfn C T 7: 25,367,961 probably null Het
Cr2 A G 1: 195,168,472 S229P probably damaging Het
Cubn T C 2: 13,430,995 Y1050C probably damaging Het
Cubn T C 2: 13,476,123 E307G probably damaging Het
Cyb5r3 A C 15: 83,160,124 Y182D possibly damaging Het
Dclre1a A T 19: 56,546,791 H120Q probably benign Het
Ddx6 T C 9: 44,635,776 I457T probably damaging Het
E2f1 A T 2: 154,564,476 H93Q possibly damaging Het
Fam186a T C 15: 99,943,317 K1682R possibly damaging Het
Farsb A G 1: 78,466,965 probably null Het
Flii A T 11: 60,721,136 L347Q probably damaging Het
Galntl6 T G 8: 58,911,441 T12P probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm21680 T C 5: 25,969,036 N190S probably damaging Het
Ifit1bl2 T C 19: 34,619,125 S364G probably benign Het
Kdm2a A G 19: 4,350,317 I234T probably damaging Het
Kdm5b T C 1: 134,599,207 C356R probably damaging Het
Kel A T 6: 41,688,851 C174* probably null Het
Krt16 T A 11: 100,246,676 D401V probably damaging Het
Ltb4r1 A C 14: 55,767,743 I168L probably benign Het
Luzp1 T A 4: 136,541,780 M438K probably benign Het
Mtf1 C T 4: 124,824,352 T281M probably damaging Het
Myo9a T A 9: 59,924,948 S2587T probably benign Het
Olfr1311 A T 2: 112,021,551 I101N probably damaging Het
Olfr1377 T A 11: 50,984,786 F28L probably benign Het
Olfr532 G T 7: 140,419,667 Y35* probably null Het
Olfr860 T C 9: 19,846,409 D70G probably damaging Het
Pcm1 T A 8: 41,293,544 F1221Y probably benign Het
Pnldc1 A T 17: 12,905,864 N90K probably damaging Het
Prickle2 A T 6: 92,420,237 L169Q probably damaging Het
Ralgps2 A T 1: 156,884,574 L147I probably damaging Het
Rfx3 A T 19: 27,768,609 L674Q possibly damaging Het
Rpl3 C A 15: 80,082,544 L14F probably damaging Het
Rrbp1 C T 2: 143,989,555 G231R probably damaging Het
Sema3d C T 5: 12,571,013 L529F probably damaging Het
Slain1 A T 14: 103,656,955 T193S probably benign Het
Slc2a6 G T 2: 27,024,587 Q256K possibly damaging Het
Slk A G 19: 47,620,183 E525G possibly damaging Het
Spsb4 G T 9: 96,944,645 Q252K probably benign Het
Taf1b A G 12: 24,558,257 T552A possibly damaging Het
Tmprss15 T C 16: 79,006,057 probably null Het
Tph2 T C 10: 115,179,326 H177R probably damaging Het
Ttll1 A G 15: 83,489,617 S332P probably damaging Het
Twf2 T G 9: 106,212,833 N128K probably benign Het
Vegfc T A 8: 54,181,230 C315S probably damaging Het
Vmn2r111 T A 17: 22,571,908 K136N probably benign Het
Wnk2 T C 13: 49,061,338 E496G probably damaging Het
Zfp148 C A 16: 33,497,198 Q705K probably damaging Het
Zw10 C T 9: 49,073,235 A539V probably damaging Het
Other mutations in Arid1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Arid1b APN 17 5337110 missense possibly damaging 0.77
IGL00340:Arid1b APN 17 5321284 missense probably damaging 1.00
IGL00886:Arid1b APN 17 5126979 missense probably damaging 0.99
IGL01161:Arid1b APN 17 5342399 missense probably damaging 1.00
IGL01391:Arid1b APN 17 5318858 splice site probably benign
IGL01456:Arid1b APN 17 5291235 missense probably damaging 1.00
IGL02152:Arid1b APN 17 5313968 missense probably damaging 1.00
IGL02288:Arid1b APN 17 5264040 missense possibly damaging 0.88
IGL02713:Arid1b APN 17 5343011 missense probably damaging 1.00
IGL02858:Arid1b APN 17 5341891 missense possibly damaging 0.92
IGL02885:Arid1b APN 17 5342153 missense probably damaging 1.00
IGL02989:Arid1b APN 17 5335047 missense probably damaging 1.00
FR4449:Arid1b UTSW 17 4995589 small insertion probably benign
PIT4142001:Arid1b UTSW 17 5339243 missense probably damaging 1.00
R0048:Arid1b UTSW 17 5314034 critical splice donor site probably null
R0124:Arid1b UTSW 17 5339330 missense probably damaging 1.00
R0153:Arid1b UTSW 17 5342932 missense probably damaging 1.00
R0465:Arid1b UTSW 17 4996260 missense possibly damaging 0.68
R0825:Arid1b UTSW 17 5342178 missense probably damaging 1.00
R1172:Arid1b UTSW 17 5339300 missense probably damaging 1.00
R1468:Arid1b UTSW 17 5242922 missense probably damaging 0.99
R1468:Arid1b UTSW 17 5242922 missense probably damaging 0.99
R1616:Arid1b UTSW 17 5339294 missense probably damaging 1.00
R1754:Arid1b UTSW 17 5279201 critical splice acceptor site probably null
R1760:Arid1b UTSW 17 5341813 missense probably damaging 0.97
R1812:Arid1b UTSW 17 5337029 missense probably benign 0.10
R1911:Arid1b UTSW 17 5342966 missense probably damaging 1.00
R3874:Arid1b UTSW 17 5336515 splice site probably null
R3913:Arid1b UTSW 17 5342257 missense possibly damaging 0.94
R3916:Arid1b UTSW 17 5342653 missense probably benign 0.25
R3922:Arid1b UTSW 17 5343041 missense probably damaging 0.97
R4119:Arid1b UTSW 17 4995794 unclassified probably benign
R4290:Arid1b UTSW 17 5040663 missense probably damaging 1.00
R4291:Arid1b UTSW 17 5040663 missense probably damaging 1.00
R4352:Arid1b UTSW 17 5097584 missense possibly damaging 0.93
R4386:Arid1b UTSW 17 4994972 unclassified probably benign
R4458:Arid1b UTSW 17 5242916 missense probably damaging 0.99
R4524:Arid1b UTSW 17 5097620 missense possibly damaging 0.93
R4622:Arid1b UTSW 17 4995050 unclassified probably benign
R4723:Arid1b UTSW 17 5337290 missense probably benign 0.01
R4782:Arid1b UTSW 17 5339221 missense probably damaging 1.00
R4799:Arid1b UTSW 17 5339221 missense probably damaging 1.00
R4910:Arid1b UTSW 17 5342203 missense probably damaging 1.00
R4946:Arid1b UTSW 17 5342843 missense probably damaging 0.99
R5083:Arid1b UTSW 17 5314018 missense possibly damaging 0.54
R5204:Arid1b UTSW 17 5343041 missense probably damaging 0.97
R5347:Arid1b UTSW 17 5291057 nonsense probably null
R5553:Arid1b UTSW 17 5313877 missense probably damaging 1.00
R5713:Arid1b UTSW 17 5336816 missense probably damaging 1.00
R5820:Arid1b UTSW 17 4996254 missense possibly damaging 0.96
R5992:Arid1b UTSW 17 4994956 unclassified probably benign
R6038:Arid1b UTSW 17 5336682 missense probably benign 0.07
R6038:Arid1b UTSW 17 5336682 missense probably benign 0.07
R6153:Arid1b UTSW 17 5242832 missense probably damaging 1.00
R6222:Arid1b UTSW 17 5327647 critical splice acceptor site probably null
R6249:Arid1b UTSW 17 5279361 missense possibly damaging 0.61
R6279:Arid1b UTSW 17 5341999 missense probably damaging 1.00
R6329:Arid1b UTSW 17 5337263 nonsense probably null
R6466:Arid1b UTSW 17 5327678 missense probably damaging 1.00
R6861:Arid1b UTSW 17 5327686 missense possibly damaging 0.93
X0023:Arid1b UTSW 17 5342393 missense probably benign 0.39
X0027:Arid1b UTSW 17 5342372 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTCAAAGGATTGTGGTGTGC -3'
(R):5'- AAAGAAGGTTACCCACTGTGC -3'

Sequencing Primer
(F):5'- CCGTGTGAGATTGGGACCAC -3'
(R):5'- AGAAGGTTACCCACTGTGCTGTTAC -3'
Posted On2018-04-27