Incidental Mutation 'R6369:Rasgrf2'
ID 512865
Institutional Source Beutler Lab
Gene Symbol Rasgrf2
Ensembl Gene ENSMUSG00000021708
Gene Name RAS protein-specific guanine nucleotide-releasing factor 2
Synonyms Grf2, 6330417G04Rik
MMRRC Submission 044519-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.222) question?
Stock # R6369 (G1)
Quality Score 84.0076
Status Validated
Chromosome 13
Chromosomal Location 92028519-92268164 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 92267954 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 17 (M17V)
Ref Sequence ENSEMBL: ENSMUSP00000149731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099326] [ENSMUST00000146492] [ENSMUST00000216219]
AlphaFold P70392
Predicted Effect probably benign
Transcript: ENSMUST00000099326
AA Change: M17V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000096930
Gene: ENSMUSG00000021708
AA Change: M17V

DomainStartEndE-ValueType
PH 23 135 1.29e-16 SMART
IQ 204 226 1.3e0 SMART
RhoGEF 247 428 2.2e-51 SMART
RasGEFN 633 775 9.35e-15 SMART
RasGEFN 786 923 6.04e-9 SMART
RasGEF 949 1186 2.97e-112 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146492
AA Change: M17V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000116203
Gene: ENSMUSG00000021708
AA Change: M17V

DomainStartEndE-ValueType
PH 23 135 1.29e-16 SMART
IQ 204 226 1.3e0 SMART
Pfam:RhoGEF 247 387 1.2e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216219
AA Change: M17V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RAS GTPases cycle between an inactive GDP-bound state and an active GTP-bound state. This gene encodes a calcium-regulated nucleotide exchange factor activating both RAS and RAS-related protein, RAC1, through the exchange of bound GDP for GTP, thereby, coordinating the signaling of distinct mitogen-activated protein kinase pathways. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit decreased Il2 and TNF-alpha production in stimulated T cells. Mice homozygous for mutations in both Rasgrf1 and Rasgrf2 exhibit no additional abnormalities than those observed in the Rasgrf1 mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn C T 17: 14,055,605 (GRCm39) R571* probably null Het
Asb18 A T 1: 89,942,193 (GRCm39) I36N probably damaging Het
Ascc3 G A 10: 50,576,081 (GRCm39) G779S probably damaging Het
Atl2 T C 17: 80,161,984 (GRCm39) Q205R probably damaging Het
Axdnd1 A G 1: 156,220,315 (GRCm39) I235T probably damaging Het
Bri3bp A G 5: 125,531,765 (GRCm39) N237S probably damaging Het
Ccdc191 A G 16: 43,735,848 (GRCm39) N256S probably benign Het
Cchcr1 T C 17: 35,839,073 (GRCm39) I474T probably damaging Het
Cd209c T C 8: 3,994,984 (GRCm39) Y60C probably damaging Het
Cd300c C A 11: 114,848,381 (GRCm39) D171Y probably damaging Het
Crb1 C T 1: 139,165,200 (GRCm39) V975M probably damaging Het
Csmd1 C T 8: 17,585,020 (GRCm39) probably benign Het
Ctnna2 A G 6: 76,957,678 (GRCm39) S524P possibly damaging Het
Eno1 T C 4: 150,324,025 (GRCm39) probably null Het
Ero1a T C 14: 45,537,415 (GRCm39) I170M probably damaging Het
Fam186a A G 15: 99,845,212 (GRCm39) M344T unknown Het
Frem1 A T 4: 82,832,029 (GRCm39) probably null Het
Gjb5 G T 4: 127,249,723 (GRCm39) D140E possibly damaging Het
Gm11595 G A 11: 99,663,381 (GRCm39) R100C unknown Het
Hk2 G T 6: 82,713,734 (GRCm39) S449R probably damaging Het
Hs3st3a1 A T 11: 64,411,427 (GRCm39) I322F probably benign Het
Itga1 T C 13: 115,102,196 (GRCm39) I1145V probably damaging Het
Kcp A G 6: 29,484,693 (GRCm39) L1295S probably damaging Het
Macf1 T C 4: 123,304,355 (GRCm39) D49G possibly damaging Het
Mef2b T A 8: 70,618,209 (GRCm39) D96E probably benign Het
Megf10 A T 18: 57,394,259 (GRCm39) D461V probably benign Het
Myom1 T C 17: 71,408,071 (GRCm39) S1104P probably damaging Het
Nab1 A G 1: 52,529,381 (GRCm39) L172P probably damaging Het
Or2g1 T G 17: 38,106,387 (GRCm39) D17E probably benign Het
Pate1 A G 9: 35,598,324 (GRCm39) V18A probably benign Het
Pink1 T C 4: 138,048,045 (GRCm39) probably null Het
Pnpla1 T A 17: 29,097,455 (GRCm39) I207N probably damaging Het
Ppp1r12b T C 1: 134,814,280 (GRCm39) E341G possibly damaging Het
Ppp1r21 C A 17: 88,889,840 (GRCm39) probably null Het
Rad52 A G 6: 119,891,168 (GRCm39) E76G unknown Het
Rad54l A G 4: 115,968,386 (GRCm39) probably null Het
Rbm42 A G 7: 30,340,738 (GRCm39) M411T unknown Het
Reln A G 5: 22,256,359 (GRCm39) I495T probably benign Het
Rnf224 A G 2: 25,125,954 (GRCm39) F133S probably damaging Het
Rrm1 C A 7: 102,095,909 (GRCm39) H87Q probably damaging Het
Sec14l2 T C 11: 4,053,962 (GRCm39) D235G possibly damaging Het
Serpinb3d G T 1: 107,008,483 (GRCm39) N127K probably benign Het
Skint7 A T 4: 111,837,490 (GRCm39) E89D probably benign Het
Slc22a5 T G 11: 53,782,196 (GRCm39) N57T probably damaging Het
Smarcd3 A T 5: 24,799,982 (GRCm39) F263I probably damaging Het
Sncaip A G 18: 53,001,676 (GRCm39) I66V probably damaging Het
Syngr1 A C 15: 79,999,791 (GRCm39) probably benign Het
Tbc1d2 A G 4: 46,614,420 (GRCm39) Y554H probably benign Het
Tmem198 T C 1: 75,456,387 (GRCm39) V44A probably benign Het
Trappc11 T C 8: 47,965,320 (GRCm39) probably null Het
Uox C T 3: 146,330,332 (GRCm39) R163* probably null Het
Vmn2r111 C T 17: 22,767,583 (GRCm39) C638Y probably damaging Het
Washc4 A G 10: 83,410,308 (GRCm39) Y632C probably damaging Het
Zfp212 T C 6: 47,907,831 (GRCm39) V270A probably benign Het
Zfp92 G A X: 72,465,574 (GRCm39) R189H possibly damaging Homo
Other mutations in Rasgrf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Rasgrf2 APN 13 92,159,425 (GRCm39) splice site probably benign
IGL01358:Rasgrf2 APN 13 92,130,749 (GRCm39) missense probably benign 0.23
IGL01666:Rasgrf2 APN 13 92,174,718 (GRCm39) missense probably damaging 1.00
IGL01930:Rasgrf2 APN 13 92,130,857 (GRCm39) missense probably damaging 0.98
IGL02230:Rasgrf2 APN 13 92,136,145 (GRCm39) missense probably damaging 1.00
IGL02630:Rasgrf2 APN 13 92,267,900 (GRCm39) missense probably damaging 1.00
IGL02690:Rasgrf2 APN 13 92,167,273 (GRCm39) missense probably damaging 1.00
IGL02943:Rasgrf2 APN 13 92,131,752 (GRCm39) missense probably damaging 1.00
IGL03067:Rasgrf2 APN 13 92,159,413 (GRCm39) missense probably damaging 0.97
IGL03342:Rasgrf2 APN 13 92,136,098 (GRCm39) missense probably damaging 1.00
IGL03405:Rasgrf2 APN 13 92,044,170 (GRCm39) missense probably damaging 1.00
R0620:Rasgrf2 UTSW 13 92,067,936 (GRCm39) splice site probably benign
R0632:Rasgrf2 UTSW 13 92,120,393 (GRCm39) missense probably benign 0.00
R0894:Rasgrf2 UTSW 13 92,130,890 (GRCm39) missense probably damaging 1.00
R1354:Rasgrf2 UTSW 13 92,165,174 (GRCm39) missense probably damaging 1.00
R1400:Rasgrf2 UTSW 13 92,035,808 (GRCm39) missense probably damaging 1.00
R1437:Rasgrf2 UTSW 13 92,167,396 (GRCm39) missense probably damaging 1.00
R1443:Rasgrf2 UTSW 13 92,131,795 (GRCm39) missense probably damaging 1.00
R1522:Rasgrf2 UTSW 13 92,044,205 (GRCm39) missense probably benign 0.00
R1553:Rasgrf2 UTSW 13 92,038,783 (GRCm39) missense probably damaging 1.00
R1613:Rasgrf2 UTSW 13 92,050,740 (GRCm39) missense probably damaging 1.00
R1883:Rasgrf2 UTSW 13 92,117,149 (GRCm39) missense probably benign
R1934:Rasgrf2 UTSW 13 92,131,825 (GRCm39) splice site probably null
R1990:Rasgrf2 UTSW 13 92,172,473 (GRCm39) missense probably damaging 1.00
R2037:Rasgrf2 UTSW 13 92,050,748 (GRCm39) missense probably damaging 0.99
R2043:Rasgrf2 UTSW 13 92,167,351 (GRCm39) missense possibly damaging 0.91
R2135:Rasgrf2 UTSW 13 92,120,374 (GRCm39) missense probably benign
R2193:Rasgrf2 UTSW 13 92,160,221 (GRCm39) splice site probably null
R2406:Rasgrf2 UTSW 13 92,120,359 (GRCm39) missense probably benign
R3055:Rasgrf2 UTSW 13 92,165,583 (GRCm39) missense probably damaging 1.00
R3916:Rasgrf2 UTSW 13 92,167,296 (GRCm39) missense probably damaging 1.00
R3954:Rasgrf2 UTSW 13 92,130,974 (GRCm39) missense probably damaging 0.98
R3955:Rasgrf2 UTSW 13 92,130,974 (GRCm39) missense probably damaging 0.98
R3956:Rasgrf2 UTSW 13 92,130,974 (GRCm39) missense probably damaging 0.98
R4133:Rasgrf2 UTSW 13 92,130,773 (GRCm39) missense possibly damaging 0.59
R4177:Rasgrf2 UTSW 13 92,038,717 (GRCm39) missense probably damaging 1.00
R4178:Rasgrf2 UTSW 13 92,038,717 (GRCm39) missense probably damaging 1.00
R4357:Rasgrf2 UTSW 13 92,038,796 (GRCm39) missense probably damaging 1.00
R4358:Rasgrf2 UTSW 13 92,038,796 (GRCm39) missense probably damaging 1.00
R4359:Rasgrf2 UTSW 13 92,038,796 (GRCm39) missense probably damaging 1.00
R4439:Rasgrf2 UTSW 13 92,131,797 (GRCm39) missense possibly damaging 0.95
R4440:Rasgrf2 UTSW 13 92,131,797 (GRCm39) missense possibly damaging 0.95
R4441:Rasgrf2 UTSW 13 92,131,797 (GRCm39) missense possibly damaging 0.95
R4564:Rasgrf2 UTSW 13 92,033,773 (GRCm39) nonsense probably null
R4576:Rasgrf2 UTSW 13 92,044,529 (GRCm39) missense possibly damaging 0.58
R4590:Rasgrf2 UTSW 13 92,174,789 (GRCm39) missense probably damaging 1.00
R4718:Rasgrf2 UTSW 13 92,138,716 (GRCm39) critical splice donor site probably null
R4778:Rasgrf2 UTSW 13 92,131,780 (GRCm39) missense probably damaging 0.99
R4790:Rasgrf2 UTSW 13 92,136,135 (GRCm39) missense probably damaging 1.00
R4808:Rasgrf2 UTSW 13 92,160,190 (GRCm39) missense probably damaging 1.00
R5151:Rasgrf2 UTSW 13 92,044,155 (GRCm39) missense probably damaging 1.00
R5286:Rasgrf2 UTSW 13 92,267,941 (GRCm39) missense possibly damaging 0.94
R5902:Rasgrf2 UTSW 13 92,068,011 (GRCm39) missense probably damaging 1.00
R6180:Rasgrf2 UTSW 13 92,165,609 (GRCm39) missense probably damaging 1.00
R6264:Rasgrf2 UTSW 13 92,167,293 (GRCm39) missense probably damaging 1.00
R6428:Rasgrf2 UTSW 13 92,136,100 (GRCm39) missense probably damaging 1.00
R6595:Rasgrf2 UTSW 13 92,167,361 (GRCm39) missense probably damaging 1.00
R6619:Rasgrf2 UTSW 13 92,165,027 (GRCm39) missense probably damaging 1.00
R6988:Rasgrf2 UTSW 13 92,033,754 (GRCm39) missense probably benign 0.02
R7026:Rasgrf2 UTSW 13 92,131,732 (GRCm39) missense probably damaging 1.00
R7038:Rasgrf2 UTSW 13 92,130,952 (GRCm39) missense possibly damaging 0.95
R7045:Rasgrf2 UTSW 13 92,159,100 (GRCm39) intron probably benign
R7056:Rasgrf2 UTSW 13 92,167,203 (GRCm39) missense probably damaging 0.99
R7058:Rasgrf2 UTSW 13 92,034,521 (GRCm39) missense probably damaging 0.99
R7256:Rasgrf2 UTSW 13 92,032,637 (GRCm39) nonsense probably null
R7392:Rasgrf2 UTSW 13 92,041,856 (GRCm39) missense
R7469:Rasgrf2 UTSW 13 92,165,530 (GRCm39) critical splice donor site probably null
R7618:Rasgrf2 UTSW 13 92,136,085 (GRCm39) missense
R7641:Rasgrf2 UTSW 13 92,267,914 (GRCm39) missense possibly damaging 0.65
R7674:Rasgrf2 UTSW 13 92,267,914 (GRCm39) missense possibly damaging 0.65
R7784:Rasgrf2 UTSW 13 92,044,201 (GRCm39) missense
R7962:Rasgrf2 UTSW 13 92,167,300 (GRCm39) missense probably damaging 0.99
R8056:Rasgrf2 UTSW 13 92,167,321 (GRCm39) missense probably damaging 0.97
R8218:Rasgrf2 UTSW 13 92,130,796 (GRCm39) missense
R8796:Rasgrf2 UTSW 13 92,038,685 (GRCm39) missense
R8913:Rasgrf2 UTSW 13 92,159,034 (GRCm39) missense probably benign 0.05
R8971:Rasgrf2 UTSW 13 92,158,225 (GRCm39) missense possibly damaging 0.80
R9020:Rasgrf2 UTSW 13 92,165,146 (GRCm39) missense possibly damaging 0.93
R9487:Rasgrf2 UTSW 13 92,267,759 (GRCm39) missense probably benign
R9562:Rasgrf2 UTSW 13 92,034,469 (GRCm39) critical splice donor site probably null
R9712:Rasgrf2 UTSW 13 92,136,092 (GRCm39) missense
R9766:Rasgrf2 UTSW 13 92,160,188 (GRCm39) missense probably damaging 1.00
R9800:Rasgrf2 UTSW 13 92,267,860 (GRCm39) missense probably damaging 0.99
X0013:Rasgrf2 UTSW 13 92,167,363 (GRCm39) missense probably damaging 1.00
X0026:Rasgrf2 UTSW 13 92,050,654 (GRCm39) missense probably damaging 0.99
Z1177:Rasgrf2 UTSW 13 92,159,081 (GRCm39) missense unknown
Z1177:Rasgrf2 UTSW 13 92,131,632 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- AGGTACCTGCTTGTCCAAAG -3'
(R):5'- TACTTCGGGTGGAGTGACAC -3'

Sequencing Primer
(F):5'- TTGTCCAAAGCGTCCCG -3'
(R):5'- ATAGGCGCCCTAGGTCTG -3'
Posted On 2018-04-27