Incidental Mutation 'R6335:Olfr1495'
ID512938
Institutional Source Beutler Lab
Gene Symbol Olfr1495
Ensembl Gene ENSMUSG00000047207
Gene Nameolfactory receptor 1495
SynonymsGA_x6K02T2RE5P-4101369-4102328, MOR266-9
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R6335 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location13764606-13770248 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13768780 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 146 (V146A)
Ref Sequence ENSEMBL: ENSMUSP00000150205 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061669] [ENSMUST00000215930] [ENSMUST00000216980]
Predicted Effect probably benign
Transcript: ENSMUST00000061669
AA Change: V146A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000057468
Gene: ENSMUSG00000047207
AA Change: V146A

DomainStartEndE-ValueType
Pfam:7tm_4 35 312 1.4e-52 PFAM
Pfam:7tm_1 45 295 1.7e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215930
AA Change: V146A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000216980
AA Change: V146A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.1284 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp11a T C 8: 12,859,481 probably null Het
Best3 G T 10: 117,002,651 V205F probably benign Het
C1qtnf1 A G 11: 118,448,134 H210R probably damaging Het
Camkv T C 9: 107,946,695 probably null Het
Cdk5rap2 A C 4: 70,266,612 D1200E possibly damaging Het
Cep192 T A 18: 67,834,713 I756N probably damaging Het
Crocc2 A T 1: 93,202,838 Q947L probably benign Het
Dcaf1 A G 9: 106,838,646 T321A possibly damaging Het
Dgkz T C 2: 91,944,379 M87V probably benign Het
Dmrt2 T A 19: 25,673,571 S40R possibly damaging Het
Dpep1 T G 8: 123,200,652 L315R probably damaging Het
Fam221b G T 4: 43,665,942 T223N possibly damaging Het
Fasn A T 11: 120,815,359 V1053E probably damaging Het
Galc T C 12: 98,242,714 D227G probably damaging Het
Grik1 A G 16: 87,947,906 L486P probably damaging Het
Grik5 A G 7: 25,013,594 S836P probably benign Het
Grpel2 T C 18: 61,719,721 K70R possibly damaging Het
Ipo7 A G 7: 110,018,468 D15G possibly damaging Het
Iqgap1 A G 7: 80,728,024 Y1284H probably damaging Het
Lmo7 T C 14: 101,900,636 S692P probably damaging Het
Mecom A G 3: 29,980,756 L447P probably damaging Het
Mtor A G 4: 148,465,927 D680G probably damaging Het
Muc16 T A 9: 18,660,708 I172F unknown Het
Musk A G 4: 58,366,811 I476M probably benign Het
Myef2 T C 2: 125,109,712 T268A probably damaging Het
Naip1 A G 13: 100,426,552 S702P probably damaging Het
Napa G T 7: 16,115,637 S258I probably benign Het
Nfasc T A 1: 132,576,394 I1039F probably damaging Het
Nlrc5 A G 8: 94,502,274 S1238G probably benign Het
Olfr1151 T A 2: 87,857,467 C97* probably null Het
Olfr340 A G 2: 36,452,722 I46V probably benign Het
Pacs1 G T 19: 5,159,977 N215K probably damaging Het
Parp10 A G 15: 76,242,188 S267P probably benign Het
Pbrm1 G T 14: 31,084,095 C995F probably damaging Het
Pcdh7 A T 5: 57,942,265 probably null Het
Ppef2 T C 5: 92,235,754 Y499C probably damaging Het
Pramef25 G T 4: 143,949,032 T408K probably benign Het
Prex2 A C 1: 11,110,320 I370L probably benign Het
Ptprd A G 4: 75,954,183 Y1350H probably damaging Het
Rasgrp1 T C 2: 117,293,870 K284E probably damaging Het
Rexo1 A T 10: 80,544,081 Y23N probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Sash3 C T X: 48,159,521 L307F probably damaging Homo
Scn9a T A 2: 66,568,264 M1L possibly damaging Het
Serpinb6e C A 13: 33,837,822 L174F probably benign Het
Siae C T 9: 37,632,981 T275I probably benign Het
Sptbn5 C A 2: 120,054,419 probably benign Het
Ss18l2 C T 9: 121,712,606 T55I probably damaging Het
Taf1c A G 8: 119,601,779 C163R probably damaging Het
Tanc2 C T 11: 105,857,556 R505W probably damaging Het
Tango6 C A 8: 106,692,676 P285Q possibly damaging Het
Tdrd9 G T 12: 112,041,752 probably null Het
Tead3 A T 17: 28,333,325 L307H probably damaging Het
Ticrr A C 7: 79,694,283 probably null Het
Trpc4 T C 3: 54,317,574 probably null Het
Upb1 A T 10: 75,428,301 T194S probably benign Het
Vav3 A G 3: 109,563,196 N566S probably benign Het
Vmn1r196 T A 13: 22,293,717 S175R probably benign Het
Zscan29 T C 2: 121,161,436 N589D possibly damaging Het
Other mutations in Olfr1495
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01542:Olfr1495 APN 19 13768537 missense probably damaging 1.00
IGL01869:Olfr1495 APN 19 13769170 missense probably benign 0.02
IGL02088:Olfr1495 APN 19 13768666 missense probably damaging 1.00
R1583:Olfr1495 UTSW 19 13768510 missense probably benign 0.10
R1713:Olfr1495 UTSW 19 13769295 missense probably benign 0.00
R1859:Olfr1495 UTSW 19 13768724 nonsense probably null
R3717:Olfr1495 UTSW 19 13769064 missense probably damaging 0.98
R3718:Olfr1495 UTSW 19 13769064 missense probably damaging 0.98
R3881:Olfr1495 UTSW 19 13768780 missense probably benign
R4370:Olfr1495 UTSW 19 13768951 missense probably benign 0.02
R4873:Olfr1495 UTSW 19 13768762 missense probably damaging 0.99
R4875:Olfr1495 UTSW 19 13768762 missense probably damaging 0.99
R6352:Olfr1495 UTSW 19 13768464 missense probably benign
R7038:Olfr1495 UTSW 19 13768351 missense probably benign
R7107:Olfr1495 UTSW 19 13769161 missense probably benign 0.22
Z1088:Olfr1495 UTSW 19 13768416 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- TCTGTCATTTGTGGAAATCTGC -3'
(R):5'- CTGCCTGGTTCACATGGATG -3'

Sequencing Primer
(F):5'- GTGGAAATCTGCTACATCACAG -3'
(R):5'- GTTCACATGGATGTCAGCAC -3'
Posted On2018-04-27