Incidental Mutation 'R6354:Trak1'
ID512972
Institutional Source Beutler Lab
Gene Symbol Trak1
Ensembl Gene ENSMUSG00000032536
Gene Nametrafficking protein, kinesin binding 1
Synonymshyrt, 2310001H13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.274) question?
Stock #R6354 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location121297502-121474918 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 121451726 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 384 (T384S)
Ref Sequence ENSEMBL: ENSMUSP00000147624 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045903] [ENSMUST00000210351] [ENSMUST00000210798] [ENSMUST00000211187] [ENSMUST00000211301] [ENSMUST00000211439]
Predicted Effect probably null
Transcript: ENSMUST00000045903
AA Change: T394S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000044482
Gene: ENSMUSG00000032536
AA Change: T394S

DomainStartEndE-ValueType
Pfam:HAP1_N 47 352 8.1e-139 PFAM
Pfam:Milton 411 580 5e-72 PFAM
low complexity region 882 897 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209446
Predicted Effect probably benign
Transcript: ENSMUST00000210351
Predicted Effect probably null
Transcript: ENSMUST00000210798
AA Change: T291S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably null
Transcript: ENSMUST00000211187
AA Change: T384S

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000211301
AA Change: T291S

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect probably null
Transcript: ENSMUST00000211439
AA Change: T291S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211699
Meta Mutation Damage Score 0.014 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.5%
  • 20x: 95.3%
Validation Efficiency 100% (56/56)
MGI Phenotype PHENOTYPE: Mice with a spontaneous mutation in this allele have various behavioral abnormalities consistent with hypertonia. Inclusions can be found in neuronal processes of the gray matter of the brainstem and spinal cord. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik T C 11: 109,794,216 K152E probably benign Het
Adamts20 C A 15: 94,347,810 C537F probably damaging Het
Apc A T 18: 34,312,528 T808S probably benign Het
Atad3a A G 4: 155,753,945 I205T possibly damaging Het
Casz1 G T 4: 148,952,542 G1754C unknown Het
Ccdc62 C T 5: 123,944,204 A232V probably damaging Het
Cdc27 C A 11: 104,534,748 D81Y probably damaging Het
Cep126 A G 9: 8,099,927 S869P probably damaging Het
Ciita A T 16: 10,523,746 K983N probably damaging Het
Clstn1 A C 4: 149,643,216 Q523P probably benign Het
Cpb2 T C 14: 75,257,705 probably null Het
Crybg2 A G 4: 134,091,136 D1710G probably benign Het
Csmd3 C T 15: 47,881,489 G1370D probably damaging Het
Cwf19l1 G T 19: 44,127,473 D172E probably benign Het
Cyp4a14 A G 4: 115,487,244 F475L probably damaging Het
Fam98c C T 7: 29,152,847 V298M probably damaging Het
Gcsh T C 8: 116,983,843 N127S probably benign Het
Gimap4 T C 6: 48,686,880 F10S possibly damaging Het
Gm4787 C T 12: 81,377,981 A468T probably damaging Het
Gm5111 G A 6: 48,590,334 probably benign Het
Gm7137 C A 10: 77,787,647 probably benign Het
Inpp1 A G 1: 52,797,065 S81P probably damaging Het
Iqce T C 5: 140,676,335 probably null Het
Ivl CCTGCTGCTGCTGCT CCTGCTGCTGCT 3: 92,571,910 probably benign Het
Krtap13 C A 16: 88,751,243 C119F probably damaging Het
Lama2 G T 10: 27,212,068 D904E probably damaging Het
Lrrc37a T A 11: 103,464,387 I2535F unknown Het
Lrrc40 T A 3: 158,061,264 L452* probably null Het
Meis1 A T 11: 19,016,184 M63K possibly damaging Het
Mpo T A 11: 87,797,346 I277N possibly damaging Het
Mtmr11 T A 3: 96,168,676 F406I probably benign Het
Muc4 T C 16: 32,754,358 S1411P probably benign Het
Odf3 A G 7: 140,850,614 probably null Het
Olfr10 A T 11: 49,317,638 I31F probably damaging Het
Olfr1189 T A 2: 88,592,134 I110N probably damaging Het
Olfr683 G A 7: 105,143,708 T195I probably benign Het
Phf21a G A 2: 92,348,937 G298R probably damaging Het
Phldb2 T C 16: 45,825,114 Y368C probably damaging Het
Pik3cb G T 9: 99,073,643 T407K probably benign Het
Robo3 A T 9: 37,417,217 probably benign Het
Sgsm1 T G 5: 113,282,656 T288P probably damaging Het
Slc5a7 A G 17: 54,277,033 S410P probably damaging Het
Tmc6 A C 11: 117,774,236 C404G probably benign Het
Tnrc6c A T 11: 117,749,614 Q1410L possibly damaging Het
Txlna A T 4: 129,634,412 L244Q probably damaging Het
Ube3c T C 5: 29,663,583 F939L probably damaging Het
Vmn2r65 T A 7: 84,940,366 I781F probably benign Het
Vmn2r72 A G 7: 85,750,539 probably null Het
Vps36 T C 8: 22,205,755 S109P probably damaging Het
Wdr66 C T 5: 123,302,755 T1125I probably damaging Het
Wrn T C 8: 33,343,638 I82M possibly damaging Het
Zbtb49 T C 5: 38,203,559 R511G possibly damaging Het
Zeb1 A G 18: 5,772,743 T1011A possibly damaging Het
Zfhx4 T C 3: 5,401,951 S2390P probably benign Het
Zfp619 C A 7: 39,534,819 T91K probably benign Het
Zfp644 A G 5: 106,636,753 S643P probably benign Het
Other mutations in Trak1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Trak1 APN 9 121443736 critical splice donor site probably null
IGL01335:Trak1 APN 9 121454316 missense possibly damaging 0.58
IGL01777:Trak1 APN 9 121431560 splice site probably null
IGL01804:Trak1 APN 9 121442685 splice site probably benign
IGL01986:Trak1 APN 9 121472967 missense probably benign 0.00
IGL02248:Trak1 APN 9 121446794 missense probably damaging 1.00
IGL02276:Trak1 APN 9 121451668 missense probably damaging 1.00
IGL02556:Trak1 APN 9 121448901 missense probably damaging 1.00
IGL03368:Trak1 APN 9 121367122 missense possibly damaging 0.66
PIT4468001:Trak1 UTSW 9 121453332 missense probably benign 0.18
R0067:Trak1 UTSW 9 121472907 missense probably damaging 1.00
R0276:Trak1 UTSW 9 121454338 missense probably damaging 0.97
R0535:Trak1 UTSW 9 121443712 missense probably null 1.00
R0629:Trak1 UTSW 9 121367167 missense probably benign 0.37
R0671:Trak1 UTSW 9 121448955 critical splice donor site probably null
R0883:Trak1 UTSW 9 121453285 missense possibly damaging 0.90
R1160:Trak1 UTSW 9 121392007 missense probably benign 0.01
R1162:Trak1 UTSW 9 121453341 missense possibly damaging 0.93
R1168:Trak1 UTSW 9 121440679 missense probably damaging 1.00
R1398:Trak1 UTSW 9 121454359 missense probably damaging 1.00
R2118:Trak1 UTSW 9 121472997 makesense probably null
R2119:Trak1 UTSW 9 121472997 makesense probably null
R2120:Trak1 UTSW 9 121472997 makesense probably null
R2137:Trak1 UTSW 9 121472962 missense possibly damaging 0.83
R3162:Trak1 UTSW 9 121451734 splice site probably benign
R3888:Trak1 UTSW 9 121442797 splice site probably null
R3889:Trak1 UTSW 9 121445873 missense probably null 0.40
R4031:Trak1 UTSW 9 121451670 missense probably damaging 1.00
R4116:Trak1 UTSW 9 121448843 missense probably damaging 1.00
R4406:Trak1 UTSW 9 121431536 missense probably damaging 1.00
R4630:Trak1 UTSW 9 121454425 missense probably benign 0.02
R4631:Trak1 UTSW 9 121454425 missense probably benign 0.02
R4632:Trak1 UTSW 9 121454425 missense probably benign 0.02
R4786:Trak1 UTSW 9 121472494 missense probably benign 0.25
R5137:Trak1 UTSW 9 121367055 intron probably benign
R5159:Trak1 UTSW 9 121460412 missense probably damaging 0.99
R5467:Trak1 UTSW 9 121446798 missense probably damaging 1.00
R5661:Trak1 UTSW 9 121443637 missense possibly damaging 0.46
R5664:Trak1 UTSW 9 121472307 missense possibly damaging 0.47
R5769:Trak1 UTSW 9 121448838 missense probably damaging 1.00
R6041:Trak1 UTSW 9 121460412 missense probably damaging 0.99
R6257:Trak1 UTSW 9 121446755 missense probably damaging 1.00
R6257:Trak1 UTSW 9 121367224 missense possibly damaging 0.92
R6399:Trak1 UTSW 9 121453496 intron probably null
R6513:Trak1 UTSW 9 121443756 missense probably benign
R6579:Trak1 UTSW 9 121443638 missense probably benign 0.29
R6940:Trak1 UTSW 9 121443718 missense possibly damaging 0.78
R7120:Trak1 UTSW 9 121460498 missense probably benign
R7304:Trak1 UTSW 9 121416212 missense probably benign
Predicted Primers PCR Primer
(F):5'- CATGGCTTGGCAGATTCTCTC -3'
(R):5'- TGAGCTCCAGCCTTAGAGAG -3'

Sequencing Primer
(F):5'- TGTATGGCATGAAGTCTGGAGAC -3'
(R):5'- TCCAGCCTTAGAGAGATGTCACTG -3'
Posted On2018-04-27