Incidental Mutation 'R6361:Mst1r'
ID 513122
Institutional Source Beutler Lab
Gene Symbol Mst1r
Ensembl Gene ENSMUSG00000032584
Gene Name macrophage stimulating 1 receptor (c-met-related tyrosine kinase)
Synonyms Fv2, Ron, STK, friend virus susceptibility 2, CDw136, Fv-2, PTK8
MMRRC Submission 044511-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.261) question?
Stock # R6361 (G1)
Quality Score 220.009
Status Validated
Chromosome 9
Chromosomal Location 107784072-107797582 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 107793052 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 1042 (M1042V)
Ref Sequence ENSEMBL: ENSMUSP00000035203 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035203] [ENSMUST00000195617]
AlphaFold Q62190
Predicted Effect probably benign
Transcript: ENSMUST00000035203
AA Change: M1042V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000035203
Gene: ENSMUSG00000032584
AA Change: M1042V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Sema 57 510 9.03e-116 SMART
PSI 528 570 8.72e-4 SMART
IPT 570 684 1.63e-18 SMART
IPT 685 769 4.03e-23 SMART
IPT 771 873 8.41e-12 SMART
IPT 878 972 5.36e0 SMART
TyrKc 1059 1318 8.2e-134 SMART
low complexity region 1349 1360 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194527
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195113
Predicted Effect probably benign
Transcript: ENSMUST00000195617
SMART Domains Protein: ENSMUSP00000142201
Gene: ENSMUSG00000032584

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Sema 57 442 3.5e-63 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: This gene encodes a precursor protein that is proteolytically cleaved to yield an alpha chain and a beta chain which form a membrane-spanning heterodimer. The encoded protein belongs to a family of cell-surface receptor tyrosine kinases involved in signaling from the cell surface to the intracellular environment. The binding of the encoded protein to its ligand, macrophage-stimulating protein, mediates several biological activities including wound healing, tumor immunity, macrophage activation and hematopoiesis as well as cell growth, motility, survival and adhesion. The protein encoded by this gene also functions in early development and the macrophage-mediated inflammatory response. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: This locus controls susceptibility to splenomegaly or spleen focus formation induced by inoculation with Friend leukemia virus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asap1 C T 15: 64,221,672 (GRCm39) probably null Het
Cabin1 G A 10: 75,562,699 (GRCm39) A29V possibly damaging Het
Cadps G A 14: 12,491,778 (GRCm38) Q791* probably null Het
Cdc14b T C 13: 64,364,023 (GRCm39) probably null Het
Cep89 C T 7: 35,097,472 (GRCm39) P33S probably damaging Het
Clec18a A G 8: 111,807,661 (GRCm39) probably benign Het
Cln5 T A 14: 103,313,637 (GRCm39) D296E probably benign Het
Col6a4 A T 9: 105,943,902 (GRCm39) S1191T probably benign Het
Crispld1 A G 1: 17,832,455 (GRCm39) I480M probably damaging Het
Dhrs7 A C 12: 72,711,433 (GRCm39) L32V probably damaging Het
Dscam T C 16: 96,424,011 (GRCm39) T1645A probably benign Het
Eif2b3 A G 4: 116,885,622 (GRCm39) T55A possibly damaging Het
Ercc6 T C 14: 32,239,067 (GRCm39) Y52H probably benign Het
Fam170b C A 14: 32,558,028 (GRCm39) Q288K unknown Het
Flt4 A G 11: 49,521,405 (GRCm39) T442A probably benign Het
Gm19402 A T 10: 77,525,895 (GRCm39) probably benign Het
Gm4841 A G 18: 60,403,832 (GRCm39) I87T probably damaging Het
Hspb7 A G 4: 141,149,860 (GRCm39) E82G possibly damaging Het
Itgb3 A G 11: 104,556,408 (GRCm39) K750E possibly damaging Het
Itsn2 A G 12: 4,679,655 (GRCm39) M155V probably benign Het
Marchf8 A T 6: 116,379,062 (GRCm39) D332V probably null Het
Muc4 T C 16: 32,587,725 (GRCm39) F2756L probably benign Het
Myl6b T A 10: 128,333,078 (GRCm39) K55* probably null Het
Or1j19 A G 2: 36,676,792 (GRCm39) N85S probably damaging Het
Or4c123 A T 2: 89,126,990 (GRCm39) I208N probably damaging Het
Or4k51 G T 2: 111,584,940 (GRCm39) L115F probably damaging Het
Or7g18 T C 9: 18,787,027 (GRCm39) Y132H probably damaging Het
Or8g50 A C 9: 39,648,968 (GRCm39) N286H probably damaging Het
Pcca A G 14: 122,875,794 (GRCm39) D141G probably benign Het
Pkd2 C T 5: 104,634,546 (GRCm39) R526* probably null Het
Polr2a C A 11: 69,634,163 (GRCm39) A756S probably damaging Het
Prkd2 T C 7: 16,581,579 (GRCm39) S145P probably damaging Het
Rhbdf1 T C 11: 32,162,915 (GRCm39) N451D possibly damaging Het
Rundc3a G A 11: 102,291,621 (GRCm39) R358Q probably damaging Het
Spata31g1 A T 4: 42,972,695 (GRCm39) D676V probably benign Het
Spef1l T A 7: 139,556,585 (GRCm39) D134V possibly damaging Het
Tbc1d4 T C 14: 101,744,610 (GRCm39) K339E probably damaging Het
Usp37 A G 1: 74,493,052 (GRCm39) I723T probably benign Het
Vwa2 A T 19: 56,889,958 (GRCm39) probably null Het
Zdbf2 A C 1: 63,342,480 (GRCm39) R286S possibly damaging Het
Zfp422 G A 6: 116,603,781 (GRCm39) H73Y probably damaging Het
Zfp868 T C 8: 70,064,564 (GRCm39) H257R probably damaging Het
Zzef1 A G 11: 72,775,175 (GRCm39) S1723G possibly damaging Het
Other mutations in Mst1r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Mst1r APN 9 107,790,449 (GRCm39) splice site probably benign
IGL01327:Mst1r APN 9 107,785,043 (GRCm39) missense probably benign 0.03
IGL01572:Mst1r APN 9 107,788,791 (GRCm39) missense probably damaging 1.00
IGL01968:Mst1r APN 9 107,794,005 (GRCm39) splice site probably null
IGL01983:Mst1r APN 9 107,794,475 (GRCm39) missense probably damaging 0.99
IGL02096:Mst1r APN 9 107,794,478 (GRCm39) missense probably damaging 0.97
IGL02203:Mst1r APN 9 107,785,068 (GRCm39) missense probably damaging 1.00
IGL02203:Mst1r APN 9 107,790,348 (GRCm39) missense possibly damaging 0.61
IGL02332:Mst1r APN 9 107,785,025 (GRCm39) nonsense probably null
IGL02402:Mst1r APN 9 107,794,026 (GRCm39) missense probably damaging 0.99
IGL02404:Mst1r APN 9 107,790,266 (GRCm39) splice site probably benign
IGL02942:Mst1r APN 9 107,790,352 (GRCm39) missense possibly damaging 0.89
IGL02951:Mst1r APN 9 107,785,403 (GRCm39) missense possibly damaging 0.88
IGL02975:Mst1r APN 9 107,790,379 (GRCm39) missense probably benign 0.20
IGL03005:Mst1r APN 9 107,791,748 (GRCm39) nonsense probably null
IGL03304:Mst1r APN 9 107,785,137 (GRCm39) missense probably damaging 1.00
R0386:Mst1r UTSW 9 107,794,003 (GRCm39) splice site probably null
R0833:Mst1r UTSW 9 107,791,975 (GRCm39) missense probably benign 0.00
R0833:Mst1r UTSW 9 107,790,366 (GRCm39) missense probably benign
R1139:Mst1r UTSW 9 107,797,168 (GRCm39) missense possibly damaging 0.93
R1371:Mst1r UTSW 9 107,794,424 (GRCm39) missense probably damaging 1.00
R1477:Mst1r UTSW 9 107,785,523 (GRCm39) missense probably benign
R1479:Mst1r UTSW 9 107,790,544 (GRCm39) splice site probably benign
R1541:Mst1r UTSW 9 107,794,562 (GRCm39) missense probably damaging 0.99
R1698:Mst1r UTSW 9 107,797,179 (GRCm39) missense probably benign 0.06
R1891:Mst1r UTSW 9 107,790,661 (GRCm39) missense probably damaging 1.00
R1971:Mst1r UTSW 9 107,790,411 (GRCm39) missense probably benign 0.06
R1974:Mst1r UTSW 9 107,793,132 (GRCm39) critical splice donor site probably null
R1974:Mst1r UTSW 9 107,791,962 (GRCm39) missense probably damaging 1.00
R2144:Mst1r UTSW 9 107,790,367 (GRCm39) missense probably benign
R2221:Mst1r UTSW 9 107,785,547 (GRCm39) missense probably damaging 1.00
R2356:Mst1r UTSW 9 107,795,069 (GRCm39) missense probably damaging 1.00
R3913:Mst1r UTSW 9 107,791,945 (GRCm39) missense probably benign
R4768:Mst1r UTSW 9 107,788,849 (GRCm39) missense probably damaging 1.00
R4793:Mst1r UTSW 9 107,797,124 (GRCm39) missense probably damaging 0.96
R5141:Mst1r UTSW 9 107,789,440 (GRCm39) missense probably damaging 0.99
R5191:Mst1r UTSW 9 107,788,750 (GRCm39) missense probably damaging 0.98
R5238:Mst1r UTSW 9 107,784,773 (GRCm39) missense probably damaging 1.00
R6024:Mst1r UTSW 9 107,785,350 (GRCm39) missense probably benign 0.00
R6220:Mst1r UTSW 9 107,784,547 (GRCm39) missense probably benign 0.11
R6256:Mst1r UTSW 9 107,794,465 (GRCm39) missense probably damaging 1.00
R6522:Mst1r UTSW 9 107,790,438 (GRCm39) missense probably benign 0.00
R6559:Mst1r UTSW 9 107,785,470 (GRCm39) missense possibly damaging 0.91
R6863:Mst1r UTSW 9 107,797,225 (GRCm39) missense probably benign
R6868:Mst1r UTSW 9 107,793,132 (GRCm39) critical splice donor site probably null
R6873:Mst1r UTSW 9 107,788,843 (GRCm39) missense possibly damaging 0.90
R6978:Mst1r UTSW 9 107,789,793 (GRCm39) missense probably benign 0.23
R7168:Mst1r UTSW 9 107,785,392 (GRCm39) missense probably benign 0.01
R7299:Mst1r UTSW 9 107,791,989 (GRCm39) missense possibly damaging 0.46
R7301:Mst1r UTSW 9 107,791,989 (GRCm39) missense possibly damaging 0.46
R7405:Mst1r UTSW 9 107,792,321 (GRCm39) missense possibly damaging 0.87
R7615:Mst1r UTSW 9 107,797,211 (GRCm39) missense probably benign 0.05
R7684:Mst1r UTSW 9 107,788,762 (GRCm39) missense probably benign 0.01
R7741:Mst1r UTSW 9 107,784,319 (GRCm39) start gained probably benign
R7916:Mst1r UTSW 9 107,784,777 (GRCm39) missense probably damaging 1.00
R7987:Mst1r UTSW 9 107,789,997 (GRCm39) splice site probably null
R8177:Mst1r UTSW 9 107,784,784 (GRCm39) missense probably damaging 1.00
R8356:Mst1r UTSW 9 107,794,463 (GRCm39) missense probably damaging 1.00
R8494:Mst1r UTSW 9 107,791,718 (GRCm39) missense possibly damaging 0.90
R8692:Mst1r UTSW 9 107,792,050 (GRCm39) missense possibly damaging 0.82
R8979:Mst1r UTSW 9 107,792,478 (GRCm39) missense probably damaging 0.98
R9012:Mst1r UTSW 9 107,791,960 (GRCm39) missense probably benign 0.01
X0026:Mst1r UTSW 9 107,790,402 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TACAGAAGTGTCCTTGGTGAGATG -3'
(R):5'- CACAAGTTAGTGTGCGGGTC -3'

Sequencing Primer
(F):5'- GCAGCAGGAGCCAGAGC -3'
(R):5'- TCGAAGTGGGGACTGCTC -3'
Posted On 2018-04-27