Incidental Mutation 'R6352:Olfr1495'
ID513311
Institutional Source Beutler Lab
Gene Symbol Olfr1495
Ensembl Gene ENSMUSG00000047207
Gene Nameolfactory receptor 1495
SynonymsGA_x6K02T2RE5P-4101369-4102328, MOR266-9
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R6352 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location13764606-13770248 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 13768464 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 41 (M41L)
Ref Sequence ENSEMBL: ENSMUSP00000150205 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061669] [ENSMUST00000215930] [ENSMUST00000216980]
Predicted Effect probably benign
Transcript: ENSMUST00000061669
AA Change: M41L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000057468
Gene: ENSMUSG00000047207
AA Change: M41L

DomainStartEndE-ValueType
Pfam:7tm_4 35 312 1.4e-52 PFAM
Pfam:7tm_1 45 295 1.7e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215930
AA Change: M41L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000216980
AA Change: M41L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.274 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 96% (48/50)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik T C 17: 48,037,136 S120G probably benign Het
Abca13 G A 11: 9,309,139 probably null Het
Aco1 G A 4: 40,186,367 R593Q probably benign Het
Adgra3 T A 5: 49,979,136 D669V probably benign Het
Adgra3 T A 5: 49,990,250 M483L probably benign Het
BC005561 A G 5: 104,520,198 E862G probably benign Het
Ccdc42 T C 11: 68,594,365 V88A probably damaging Het
Cdh16 G C 8: 104,616,992 S624C probably damaging Het
Cpt1c A T 7: 44,966,795 probably null Het
Cul9 T C 17: 46,511,315 T1795A probably benign Het
Dnah2 C T 11: 69,448,227 V3098I probably damaging Het
Fam126b A G 1: 58,557,312 V38A probably damaging Het
Fbxl16 T C 17: 25,818,945 L426P probably damaging Het
Flt4 T C 11: 49,643,506 I1168T probably benign Het
Fmo5 T C 3: 97,645,675 V313A probably benign Het
Foxj3 A G 4: 119,585,778 N133S probably damaging Het
Gbp8 T C 5: 105,015,060 I489M possibly damaging Het
Gm10801 TC TCGAC 2: 98,663,806 probably benign Het
Hdgfl1 T G 13: 26,769,750 E113D probably benign Het
Heatr5a A T 12: 51,951,166 S317T possibly damaging Het
Insr C T 8: 3,173,479 probably null Het
Iqcf5 A G 9: 106,515,730 E62G possibly damaging Het
Kcnj3 G A 2: 55,437,549 V117I probably benign Het
Klf9 T A 19: 23,141,774 M7K probably benign Het
Mboat1 G A 13: 30,202,420 G139E possibly damaging Het
Mical3 T C 6: 120,952,473 T1811A probably damaging Het
Mllt10 A C 2: 18,123,793 K117T probably damaging Het
Mpped1 A G 15: 83,836,363 D8G probably damaging Het
Myh4 A T 11: 67,252,282 D1012V probably damaging Het
Myo9b C A 8: 71,348,410 P1070T probably benign Het
Myo9b C T 8: 71,348,411 P1071L probably benign Het
Nlrp1b T A 11: 71,181,701 I439F probably damaging Het
Nlrp9a T A 7: 26,557,626 I134N probably damaging Het
Nop2 C T 6: 125,137,207 T212M probably benign Het
Notch4 T C 17: 34,567,461 C188R probably damaging Het
Olfr703 G T 7: 106,845,222 V204F probably damaging Het
Pgd C T 4: 149,160,752 probably null Het
Plet1 T C 9: 50,501,107 S142P probably damaging Het
Ptk7 A T 17: 46,576,890 W539R probably benign Het
Ptprd A T 4: 76,091,552 probably null Het
Rgs22 T G 15: 36,092,921 Q402P probably damaging Het
Rpl10a T C 17: 28,330,846 V167A possibly damaging Het
Sdr16c5 A G 4: 4,016,421 S2P probably benign Het
Slc14a2 T C 18: 78,209,094 M1V probably null Het
Spta1 T A 1: 174,211,646 M1185K possibly damaging Het
Syde2 G T 3: 145,998,474 E127* probably null Het
Ugt2b38 T A 5: 87,424,001 R57S possibly damaging Het
Wdr11 C T 7: 129,606,675 L385F possibly damaging Het
Wdr74 T C 19: 8,739,458 V200A possibly damaging Het
Other mutations in Olfr1495
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01542:Olfr1495 APN 19 13768537 missense probably damaging 1.00
IGL01869:Olfr1495 APN 19 13769170 missense probably benign 0.02
IGL02088:Olfr1495 APN 19 13768666 missense probably damaging 1.00
R1583:Olfr1495 UTSW 19 13768510 missense probably benign 0.10
R1713:Olfr1495 UTSW 19 13769295 missense probably benign 0.00
R1859:Olfr1495 UTSW 19 13768724 nonsense probably null
R3717:Olfr1495 UTSW 19 13769064 missense probably damaging 0.98
R3718:Olfr1495 UTSW 19 13769064 missense probably damaging 0.98
R3881:Olfr1495 UTSW 19 13768780 missense probably benign
R4370:Olfr1495 UTSW 19 13768951 missense probably benign 0.02
R4873:Olfr1495 UTSW 19 13768762 missense probably damaging 0.99
R4875:Olfr1495 UTSW 19 13768762 missense probably damaging 0.99
R6335:Olfr1495 UTSW 19 13768780 missense probably benign
R7038:Olfr1495 UTSW 19 13768351 missense probably benign
R7107:Olfr1495 UTSW 19 13769161 missense probably benign 0.22
Z1088:Olfr1495 UTSW 19 13768416 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- ACTCAGAATTGGCCTCTCTACC -3'
(R):5'- ATCCGTGCAGCCAAAGACAG -3'

Sequencing Primer
(F):5'- CCTTCATATAAGCCATCAATCATTGG -3'
(R):5'- CACAACCAGCCAGTGATATGGG -3'
Posted On2018-04-27