Incidental Mutation 'R6358:Zfpm1'
ID513341
Institutional Source Beutler Lab
Gene Symbol Zfpm1
Ensembl Gene ENSMUSG00000049577
Gene Namezinc finger protein, multitype 1
SynonymsFog1, Friend of GATA-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.767) question?
Stock #R6358 (G1)
Quality Score194.009
Status Validated
Chromosome8
Chromosomal Location122282141-122337251 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 122337111 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054052] [ENSMUST00000127664]
Predicted Effect unknown
Transcript: ENSMUST00000054052
AA Change: I970V
SMART Domains Protein: ENSMUSP00000058037
Gene: ENSMUSG00000049577
AA Change: I970V

DomainStartEndE-ValueType
low complexity region 32 72 N/A INTRINSIC
low complexity region 86 94 N/A INTRINSIC
ZnF_C2H2 255 275 3.13e1 SMART
ZnF_C2H2 303 327 1.69e-3 SMART
ZnF_C2H2 333 355 1.53e-1 SMART
ZnF_C2H2 361 384 9.46e0 SMART
low complexity region 508 525 N/A INTRINSIC
low complexity region 570 578 N/A INTRINSIC
ZnF_C2H2 590 610 1.41e2 SMART
low complexity region 626 643 N/A INTRINSIC
low complexity region 644 663 N/A INTRINSIC
ZnF_C2H2 696 723 1.78e2 SMART
low complexity region 725 755 N/A INTRINSIC
low complexity region 761 779 N/A INTRINSIC
low complexity region 785 806 N/A INTRINSIC
low complexity region 823 834 N/A INTRINSIC
ZnF_C2H2 836 856 7.77e1 SMART
ZnF_C2H2 868 891 1.96e1 SMART
low complexity region 948 961 N/A INTRINSIC
ZnF_C2H2 963 989 4.99e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176690
SMART Domains Protein: ENSMUSP00000135092
Gene: ENSMUSG00000049577

DomainStartEndE-ValueType
ZnF_C2H2 51 71 3.13e1 SMART
ZnF_C2H2 99 123 1.69e-3 SMART
ZnF_C2H2 129 151 1.53e-1 SMART
ZnF_C2H2 157 180 9.46e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177356
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210581
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212315
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (61/61)
MGI Phenotype PHENOTYPE: Homozygous mutants have poorly vascularized yolk sacs and small, pale livers. Mutants die between embryonic days 10.5 and 12.5 with severe anemia associated with a block in megakaryocyte development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam39 T C 8: 40,826,681 V703A probably benign Het
Adgrv1 T A 13: 81,414,583 Q5389L probably damaging Het
Aldh18a1 A T 19: 40,577,678 I42N possibly damaging Het
Ankrd28 A C 14: 31,710,864 C575W probably damaging Het
Car14 T A 3: 95,898,175 T329S possibly damaging Het
Cdhr2 T C 13: 54,736,546 F1298S probably damaging Het
Crhr2 A G 6: 55,093,043 I341T probably benign Het
D5Ertd579e T A 5: 36,616,236 probably null Het
Emilin1 A G 5: 30,918,218 E601G probably damaging Het
Erbin T A 13: 103,845,565 Q456L probably damaging Het
Glp1r T C 17: 30,932,644 V405A probably benign Het
Gm10220 C G 5: 26,120,305 probably null Het
Gm2016 A G 12: 87,877,000 E139G unknown Het
Gm527 A T 12: 64,923,548 H219L possibly damaging Het
Gorasp2 T A 2: 70,672,760 M1K probably null Het
H2-DMa T A 17: 34,137,984 L152H probably damaging Het
Hsd3b7 T A 7: 127,801,537 H54Q probably damaging Het
Hspa12b T C 2: 131,137,066 probably benign Het
Iars C A 13: 49,727,143 T1006K possibly damaging Het
Jmjd1c T C 10: 67,225,939 V1357A probably benign Het
Magi3 T C 3: 104,050,952 M606V probably damaging Het
Mia T C 7: 27,180,978 D24G probably benign Het
Mon2 A T 10: 123,013,504 L1297Q probably damaging Het
Musk T A 4: 58,373,171 S691T possibly damaging Het
Myo5c A T 9: 75,296,012 E1463D possibly damaging Het
Ndufs6 C T 13: 73,320,319 G87D probably damaging Het
Npnt C T 3: 132,904,718 V415I probably benign Het
Ntsr2 A G 12: 16,656,768 I266V probably benign Het
Olfr259 T C 2: 87,108,434 probably benign Het
Olfr736 A T 14: 50,393,388 I211F possibly damaging Het
Pkmyt1 T A 17: 23,733,656 probably null Het
Polr1e T C 4: 45,026,813 L166P probably damaging Het
Ppib T G 9: 66,061,474 F48C probably damaging Het
Ppl C A 16: 5,087,929 E1501* probably null Het
Prpf8 T C 11: 75,491,495 V384A probably benign Het
Ptch1 T G 13: 63,513,689 S1212R probably damaging Het
Ralb C A 1: 119,476,005 D131Y probably damaging Het
Rfx4 T A 10: 84,844,235 M141K probably damaging Het
Rgl2 T A 17: 33,937,131 probably null Het
Rpl27 A G 11: 101,443,956 probably benign Het
Sdc1 A C 12: 8,791,297 T213P probably damaging Het
Setx T A 2: 29,171,348 N2256K possibly damaging Het
Shank2 A G 7: 144,031,297 M12V probably benign Het
Slc22a28 T A 19: 8,071,888 K332M probably damaging Het
Slf2 A T 19: 44,935,425 H226L probably benign Het
Tbc1d10b T C 7: 127,203,412 S362G probably benign Het
Tbxas1 G A 6: 38,952,112 probably benign Het
Tctn1 A G 5: 122,261,512 V83A probably damaging Het
Tgm4 A G 9: 123,056,518 E375G probably damaging Het
Tmeff2 T A 1: 51,133,114 Y247* probably null Het
Tmem167b C T 3: 108,558,895 R79H possibly damaging Het
Tmprss7 T G 16: 45,669,573 M429L probably benign Het
Tnfsf18 T A 1: 161,503,579 D99E probably benign Het
Tnrc18 A T 5: 142,727,981 S2534T probably damaging Het
Tnxb A G 17: 34,678,994 E872G probably damaging Het
Tomm40l C T 1: 171,219,637 V237I possibly damaging Het
Trbv2 A G 6: 41,047,902 Q84R probably benign Het
Tspan18 T C 2: 93,209,874 R179G probably benign Het
Tspan8 G T 10: 115,833,227 V56L probably benign Het
Zbtb22 T C 17: 33,918,737 S619P probably damaging Het
Zfp2 A T 11: 50,900,601 I205N probably damaging Het
Other mutations in Zfpm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02540:Zfpm1 APN 8 122332120 missense possibly damaging 0.65
R0006:Zfpm1 UTSW 8 122334488 missense probably damaging 1.00
R0508:Zfpm1 UTSW 8 122335133 missense probably damaging 1.00
R0631:Zfpm1 UTSW 8 122336874 intron probably benign
R0729:Zfpm1 UTSW 8 122336659 missense probably benign 0.20
R0883:Zfpm1 UTSW 8 122335846 missense probably damaging 0.99
R1469:Zfpm1 UTSW 8 122335846 missense probably damaging 0.99
R1469:Zfpm1 UTSW 8 122335846 missense probably damaging 0.99
R1509:Zfpm1 UTSW 8 122307546 missense possibly damaging 0.63
R1938:Zfpm1 UTSW 8 122334924 splice site probably null
R2060:Zfpm1 UTSW 8 122336592 missense probably benign 0.37
R3735:Zfpm1 UTSW 8 122323736 missense possibly damaging 0.83
R3736:Zfpm1 UTSW 8 122323736 missense possibly damaging 0.83
R4528:Zfpm1 UTSW 8 122335642 missense probably benign 0.06
R4735:Zfpm1 UTSW 8 122335480 missense probably benign 0.24
R4924:Zfpm1 UTSW 8 122334608 missense possibly damaging 0.95
R5347:Zfpm1 UTSW 8 122335530 missense possibly damaging 0.94
R5375:Zfpm1 UTSW 8 122336073 missense probably benign 0.00
R5470:Zfpm1 UTSW 8 122333793 missense probably damaging 0.99
R6768:Zfpm1 UTSW 8 122334456 missense probably damaging 1.00
R6966:Zfpm1 UTSW 8 122332165 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGACCTGGTTGAGCATTTGC -3'
(R):5'- CACTAGATCTAAGACAACAGGCTG -3'

Sequencing Primer
(F):5'- GCCTGCAGGTGGCCAAG -3'
(R):5'- GGGCCTCCAGCGAATTTATCAC -3'
Posted On2018-04-27