Incidental Mutation 'R6370:Slc6a18'
ID513495
Institutional Source Beutler Lab
Gene Symbol Slc6a18
Ensembl Gene ENSMUSG00000021612
Gene Namesolute carrier family 6 (neurotransmitter transporter), member 18
SynonymsXtrp2, D630001K16Rik, XT2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6370 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location73661752-73678023 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 73668159 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 367 (T367I)
Ref Sequence ENSEMBL: ENSMUSP00000152146 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022105] [ENSMUST00000109679] [ENSMUST00000109680] [ENSMUST00000220650] [ENSMUST00000222029] [ENSMUST00000223026] [ENSMUST00000223074]
Predicted Effect probably benign
Transcript: ENSMUST00000022105
AA Change: T367I

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000022105
Gene: ENSMUSG00000021612
AA Change: T367I

DomainStartEndE-ValueType
Pfam:SNF 17 593 2.1e-182 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109679
AA Change: T367I

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000105301
Gene: ENSMUSG00000021612
AA Change: T367I

DomainStartEndE-ValueType
Pfam:SNF 17 511 6.8e-164 PFAM
low complexity region 513 526 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109680
AA Change: T367I

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000105302
Gene: ENSMUSG00000021612
AA Change: T367I

DomainStartEndE-ValueType
Pfam:SNF 17 325 2.1e-126 PFAM
Pfam:SNF 392 555 9.1e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220650
AA Change: T367I

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000220703
Predicted Effect probably benign
Transcript: ENSMUST00000222029
AA Change: T367I

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000223026
AA Change: T367I

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000223074
AA Change: T367I

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 95% (54/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The SLC6 family of proteins, which includes SLC6A18, act as specific transporters for neurotransmitters, amino acids, and osmolytes like betaine, taurine, and creatine. SLC6 proteins are sodium cotransporters that derive the energy for solute transport from the electrochemical gradient for sodium ions (Hoglund et al., 2005 [PubMed 16125675]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Homozygous null mice are overtly normal but have increased blood pressure associated with impaired renal accumulation of glycine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asb6 A G 2: 30,827,012 V67A probably damaging Het
Atic T A 1: 71,578,660 F590I probably damaging Het
Atxn10 T C 15: 85,393,385 F351S probably damaging Het
Bcl2l13 A G 6: 120,865,622 N92S probably benign Het
Carm1 G T 9: 21,587,519 A518S probably benign Het
Ccar1 C T 10: 62,764,529 R541H probably damaging Het
Cfhr2 A T 1: 139,822,327 L96Q probably damaging Het
Chrnb4 A G 9: 55,034,859 L377S probably benign Het
Clcn3 A G 8: 60,923,024 Y639H probably damaging Het
Cngb1 C T 8: 95,264,422 M717I probably benign Het
Ctcf T C 8: 105,664,220 M153T probably benign Het
Cyp2b19 T C 7: 26,763,358 S222P probably benign Het
Dixdc1 A T 9: 50,682,223 probably null Het
Entpd2 G A 2: 25,397,417 G47S probably damaging Het
Erbb3 A G 10: 128,570,074 M1158T possibly damaging Het
Faah T C 4: 116,003,056 D333G probably damaging Het
Foxred2 T A 15: 77,943,306 T618S probably benign Het
Gm2381 G A 7: 42,820,586 A38V probably benign Het
Gpx5 A T 13: 21,288,702 probably null Het
Gtdc1 A G 2: 44,756,322 V98A probably damaging Het
Hal T C 10: 93,497,506 I312T probably damaging Het
Krtap21-1 T C 16: 89,403,631 Y41C unknown Het
Larp6 A G 9: 60,737,363 E262G probably damaging Het
Lrrn1 A G 6: 107,569,224 Y661C probably damaging Het
Lsm14a A G 7: 34,357,481 V244A probably benign Het
Marc1 T C 1: 184,795,492 D257G probably damaging Het
Mfrp T C 9: 44,106,261 C517R probably damaging Het
Ncoa3 T C 2: 166,065,905 S1145P probably benign Het
Nosip G T 7: 45,076,740 probably null Het
Olfr1186 T A 2: 88,499,368 C94* probably null Het
Olfr568 A T 7: 102,877,170 T17S probably benign Het
Olfr664 T C 7: 104,733,917 K149R probably benign Het
Phykpl T C 11: 51,586,716 S112P probably damaging Het
Pik3cb A T 9: 99,040,934 I1015K probably damaging Het
Pomt2 A G 12: 87,109,199 W818R probably damaging Het
Ptpn21 A T 12: 98,689,034 M558K possibly damaging Het
Rnf213 T A 11: 119,477,078 N4647K probably damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Homo
Rxrg T C 1: 167,634,437 V227A probably damaging Het
Satb1 A T 17: 51,782,797 S341T possibly damaging Het
Skint5 T G 4: 113,614,110 Q983P unknown Het
Slc7a1 A G 5: 148,340,673 L344P probably damaging Het
Slc7a6 T A 8: 106,195,437 F399I probably benign Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Sugt1 T C 14: 79,610,334 V208A probably benign Het
Syt3 A G 7: 44,395,683 K480E probably damaging Het
Thop1 C T 10: 81,077,983 T186I probably benign Het
Trim55 G A 3: 19,691,486 E509K possibly damaging Het
Upf2 A G 2: 5,976,010 N469S unknown Het
Usp24 G T 4: 106,380,521 K1125N probably null Het
Usp5 A T 6: 124,820,428 D494E probably benign Het
Vmn2r51 T C 7: 10,098,216 K481R probably damaging Het
Vps16 C A 2: 130,443,384 A787D probably damaging Het
Washc4 C T 10: 83,571,362 H488Y possibly damaging Het
Wdfy4 C A 14: 33,068,850 A2053S probably benign Het
Zfp74 A T 7: 29,932,410 D136E probably damaging Het
Other mutations in Slc6a18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Slc6a18 APN 13 73671719 missense possibly damaging 0.82
IGL01370:Slc6a18 APN 13 73667031 missense probably damaging 1.00
IGL01959:Slc6a18 APN 13 73677865 missense probably damaging 1.00
IGL02096:Slc6a18 APN 13 73672751 missense probably benign 0.05
IGL02147:Slc6a18 APN 13 73668162 missense probably damaging 0.97
IGL02167:Slc6a18 APN 13 73666472 critical splice acceptor site probably null
IGL02465:Slc6a18 APN 13 73677785 missense probably benign 0.11
IGL02548:Slc6a18 APN 13 73669995 missense probably damaging 1.00
IGL02720:Slc6a18 APN 13 73669968 missense probably benign 0.16
IGL03341:Slc6a18 APN 13 73677923 missense probably benign 0.07
R0011:Slc6a18 UTSW 13 73665619 missense possibly damaging 0.59
R0219:Slc6a18 UTSW 13 73674632 splice site probably null
R0884:Slc6a18 UTSW 13 73667037 missense probably damaging 1.00
R1019:Slc6a18 UTSW 13 73677879 missense probably damaging 1.00
R1610:Slc6a18 UTSW 13 73668225 missense probably benign 0.10
R1901:Slc6a18 UTSW 13 73670043 missense probably benign 0.39
R1969:Slc6a18 UTSW 13 73664189 missense possibly damaging 0.66
R2014:Slc6a18 UTSW 13 73675725 missense probably benign 0.02
R2445:Slc6a18 UTSW 13 73666752 nonsense probably null
R2504:Slc6a18 UTSW 13 73675806 missense probably benign 0.01
R3125:Slc6a18 UTSW 13 73677802 missense probably damaging 1.00
R4084:Slc6a18 UTSW 13 73667029 missense probably benign 0.39
R4571:Slc6a18 UTSW 13 73666370 missense possibly damaging 0.59
R4735:Slc6a18 UTSW 13 73666435 missense probably benign 0.42
R5032:Slc6a18 UTSW 13 73666323 missense probably damaging 1.00
R5859:Slc6a18 UTSW 13 73668159 missense probably benign 0.01
R6258:Slc6a18 UTSW 13 73670045 nonsense probably null
R6350:Slc6a18 UTSW 13 73677925 missense possibly damaging 0.80
R6640:Slc6a18 UTSW 13 73664282 missense possibly damaging 0.95
R6747:Slc6a18 UTSW 13 73677991 start gained probably benign
R7267:Slc6a18 UTSW 13 73671636 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCATCCTGTCTGCCAGATG -3'
(R):5'- TGCTATTTGCTCGAGAACTTTC -3'

Sequencing Primer
(F):5'- TCTGCATGCTCCCTAAGT -3'
(R):5'- CTCGAGAACTTTCCTGGAATACTGG -3'
Posted On2018-04-27