Incidental Mutation 'R6371:Crocc2'
ID513506
Institutional Source Beutler Lab
Gene Symbol Crocc2
Ensembl Gene ENSMUSG00000084989
Gene Nameciliary rootlet coiled-coil, rootletin family member 2
SynonymsLOC381284, E030010N08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R6371 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location93168725-93231072 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 93215631 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 1318 (N1318K)
Ref Sequence ENSEMBL: ENSMUSP00000120588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000138595]
Predicted Effect probably benign
Transcript: ENSMUST00000138595
AA Change: N1318K

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000120588
Gene: ENSMUSG00000084989
AA Change: N1318K

DomainStartEndE-ValueType
low complexity region 67 82 N/A INTRINSIC
Pfam:Rootletin 89 260 5.1e-24 PFAM
coiled coil region 281 346 N/A INTRINSIC
internal_repeat_1 381 424 9.68e-9 PROSPERO
internal_repeat_3 389 414 5.46e-6 PROSPERO
internal_repeat_4 398 425 1.1e-5 PROSPERO
coiled coil region 426 627 N/A INTRINSIC
coiled coil region 655 1247 N/A INTRINSIC
internal_repeat_2 1252 1280 6.61e-7 PROSPERO
internal_repeat_4 1341 1374 1.1e-5 PROSPERO
internal_repeat_1 1347 1384 9.68e-9 PROSPERO
coiled coil region 1403 1512 N/A INTRINSIC
coiled coil region 1539 1582 N/A INTRINSIC
low complexity region 1590 1604 N/A INTRINSIC
Meta Mutation Damage Score 0.1244 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.2%
  • 20x: 94.1%
Validation Efficiency 98% (50/51)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b C T 12: 113,490,274 S237L probably damaging Het
Ank3 T G 10: 69,808,879 L58V probably damaging Het
Arsb A T 13: 93,790,066 I115F possibly damaging Het
Atad2b T C 12: 4,973,970 Y32H probably damaging Het
Brd1 A C 15: 88,713,998 M515R probably benign Het
Cbx7 A G 15: 79,918,822 S30P possibly damaging Het
Cdk12 A G 11: 98,245,288 T1123A unknown Het
Cep170b A G 12: 112,740,945 D375G probably damaging Het
Clcn3 T C 8: 60,937,335 K164E probably benign Het
Clip4 A C 17: 71,856,464 K677T probably damaging Het
Clrn2 T C 5: 45,460,198 I137T possibly damaging Het
Cntln T C 4: 84,884,579 S39P probably damaging Het
Emc1 C T 4: 139,371,665 Q820* probably null Het
Fam71e2 A G 7: 4,759,359 V257A probably benign Het
Fbxl2 G A 9: 113,989,383 T170I probably damaging Het
Fyb2 A G 4: 104,995,778 T552A probably damaging Het
Gm2381 G A 7: 42,820,586 A38V probably benign Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Helz2 C T 2: 181,233,467 E1745K probably damaging Het
Hspg2 T C 4: 137,541,695 Y2213H probably damaging Het
Ifnar2 T C 16: 91,388,098 Y24H possibly damaging Het
Inpp5d T A 1: 87,699,675 L566Q probably damaging Het
Itgb2 C A 10: 77,548,597 P184H probably damaging Het
Kcnb2 T A 1: 15,711,212 D769E probably benign Het
Lrp1b A G 2: 40,851,654 M3087T possibly damaging Het
Ltbp3 A G 19: 5,745,772 probably null Het
Ms4a6b A G 19: 11,520,364 E9G probably damaging Het
Nat3 G A 8: 67,524,179 probably null Het
Ndufaf1 A T 2: 119,660,053 D175E probably damaging Het
Nop58 T G 1: 59,711,312 probably benign Het
Olfr122 A G 17: 37,772,435 T261A probably benign Het
Olfr285 A G 15: 98,313,338 Y71H possibly damaging Het
P3h4 C T 11: 100,411,749 E354K probably benign Het
Plekhm2 T G 4: 141,629,532 T787P possibly damaging Het
Ppia C T 11: 6,418,230 T37I probably benign Het
Reln T A 5: 21,995,513 M1330L probably benign Het
Ric1 A G 19: 29,562,026 E53G probably benign Het
Sgip1 T A 4: 102,966,285 V721E probably damaging Het
Slc33a1 A T 3: 63,943,288 D538E probably benign Het
Son T C 16: 91,674,741 Het
Srebf1 A T 11: 60,203,515 S591R probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Taok2 G A 7: 126,870,147 R1170W probably damaging Het
Tsc2 A T 17: 24,626,714 V210E probably benign Het
Ttc6 T A 12: 57,728,463 N1648K possibly damaging Het
Vgll3 C T 16: 65,839,245 P94L probably damaging Het
Vmn2r54 A T 7: 12,615,435 V740E probably damaging Het
Yeats2 A G 16: 20,221,710 E1127G possibly damaging Het
Zfp709 T A 8: 71,889,485 Y252N probably damaging Het
Other mutations in Crocc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Crocc2 APN 1 93217044 nonsense probably null
R0396:Crocc2 UTSW 1 93224214 splice site probably benign
R1382:Crocc2 UTSW 1 93217093 critical splice donor site probably null
R4608:Crocc2 UTSW 1 93168794 missense possibly damaging 0.95
R4609:Crocc2 UTSW 1 93168794 missense possibly damaging 0.95
R4619:Crocc2 UTSW 1 93213650 missense probably benign
R4646:Crocc2 UTSW 1 93168794 missense possibly damaging 0.95
R4647:Crocc2 UTSW 1 93168794 missense possibly damaging 0.95
R4648:Crocc2 UTSW 1 93168794 missense possibly damaging 0.95
R4767:Crocc2 UTSW 1 93202856 missense possibly damaging 0.72
R4811:Crocc2 UTSW 1 93205896 missense probably damaging 0.99
R5046:Crocc2 UTSW 1 93205902 missense probably damaging 0.96
R5389:Crocc2 UTSW 1 93215641 missense probably benign 0.03
R5632:Crocc2 UTSW 1 93217853 missense probably damaging 0.98
R5887:Crocc2 UTSW 1 93194116 missense possibly damaging 0.47
R6128:Crocc2 UTSW 1 93194401 missense probably benign 0.28
R6142:Crocc2 UTSW 1 93190479 missense possibly damaging 0.61
R6258:Crocc2 UTSW 1 93213638 missense possibly damaging 0.57
R6260:Crocc2 UTSW 1 93213638 missense possibly damaging 0.57
R6288:Crocc2 UTSW 1 93194505 missense probably benign 0.07
R6312:Crocc2 UTSW 1 93215710 nonsense probably null
R6335:Crocc2 UTSW 1 93202838 missense probably benign 0.02
R6339:Crocc2 UTSW 1 93214032 missense probably benign 0.23
R6439:Crocc2 UTSW 1 93183404 missense possibly damaging 0.81
R6442:Crocc2 UTSW 1 93185053 missense probably benign 0.38
R6545:Crocc2 UTSW 1 93212937 missense probably benign 0.45
R6619:Crocc2 UTSW 1 93190501 missense probably benign 0.09
R6898:Crocc2 UTSW 1 93215582 missense probably benign 0.06
R7170:Crocc2 UTSW 1 93193982 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGGGGCATCTTTGTGAGAGC -3'
(R):5'- AAGCACAGACTCCTAAAGTTGTTAG -3'

Sequencing Primer
(F):5'- GCATCTTTGTGAGAGCCAGAG -3'
(R):5'- AGCCTCCTTATTACATAGGCCATGAG -3'
Posted On2018-04-27