Incidental Mutation 'R6371:Cbx7'
ID513538
Institutional Source Beutler Lab
Gene Symbol Cbx7
Ensembl Gene ENSMUSG00000053411
Gene Namechromobox 7
SynonymsD15Ertd417e, 1600014J01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.220) question?
Stock #R6371 (G1)
Quality Score177.009
Status Validated
Chromosome15
Chromosomal Location79915807-79971119 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 79918822 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 30 (S30P)
Ref Sequence ENSEMBL: ENSMUSP00000118871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089293] [ENSMUST00000109615] [ENSMUST00000109616] [ENSMUST00000128931] [ENSMUST00000132821] [ENSMUST00000146719] [ENSMUST00000177044] [ENSMUST00000177098]
Predicted Effect probably benign
Transcript: ENSMUST00000089293
AA Change: S177P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000086708
Gene: ENSMUSG00000053411
AA Change: S177P

DomainStartEndE-ValueType
CHROMO 10 62 3.12e-18 SMART
low complexity region 68 85 N/A INTRINSIC
low complexity region 190 202 N/A INTRINSIC
PDB:3GS2|D 219 248 2e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000109615
AA Change: S84P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105244
Gene: ENSMUSG00000053411
AA Change: S84P

DomainStartEndE-ValueType
CHROMO 10 62 3.12e-18 SMART
low complexity region 70 81 N/A INTRINSIC
low complexity region 97 109 N/A INTRINSIC
PDB:3GS2|D 126 155 1e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000109616
AA Change: S84P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105245
Gene: ENSMUSG00000053411
AA Change: S84P

DomainStartEndE-ValueType
CHROMO 10 62 3.12e-18 SMART
low complexity region 70 81 N/A INTRINSIC
low complexity region 97 109 N/A INTRINSIC
PDB:3GS2|D 126 155 1e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000128931
AA Change: S64P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000118813
Gene: ENSMUSG00000053411
AA Change: S64P

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 77 89 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000132821
AA Change: S30P

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000118871
Gene: ENSMUSG00000053411
AA Change: S30P

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146719
AA Change: S106P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000120748
Gene: ENSMUSG00000053411
AA Change: S106P

DomainStartEndE-ValueType
CHROMO 2 84 4.03e-12 SMART
low complexity region 92 103 N/A INTRINSIC
low complexity region 119 131 N/A INTRINSIC
PDB:3GS2|D 148 177 6e-12 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176639
Predicted Effect probably benign
Transcript: ENSMUST00000177044
SMART Domains Protein: ENSMUSP00000135246
Gene: ENSMUSG00000053411

DomainStartEndE-ValueType
CHROMO 10 56 3.71e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177098
SMART Domains Protein: ENSMUSP00000135079
Gene: ENSMUSG00000009585

DomainStartEndE-ValueType
Pfam:APOBEC_N 31 209 6.8e-37 PFAM
Pfam:APOBEC_C 147 201 6e-23 PFAM
Pfam:APOBEC_N 216 386 1.2e-27 PFAM
Pfam:APOBEC_C 325 378 3.1e-21 PFAM
Meta Mutation Damage Score 0.054 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.2%
  • 20x: 94.1%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains the CHROMO (CHRomatin Organization MOdifier) domain. The encoded protein is a component of the Polycomb repressive complex 1 (PRC1), and is thought to control the lifespan of several normal human cells. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased body length and develop liver and lung adenomas and carcinomas while mutant embryonic fibriblasts show a higher growth rate and reduced susceptibility to senescence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b C T 12: 113,490,274 S237L probably damaging Het
Ank3 T G 10: 69,808,879 L58V probably damaging Het
Arsb A T 13: 93,790,066 I115F possibly damaging Het
Atad2b T C 12: 4,973,970 Y32H probably damaging Het
Brd1 A C 15: 88,713,998 M515R probably benign Het
Cdk12 A G 11: 98,245,288 T1123A unknown Het
Cep170b A G 12: 112,740,945 D375G probably damaging Het
Clcn3 T C 8: 60,937,335 K164E probably benign Het
Clip4 A C 17: 71,856,464 K677T probably damaging Het
Clrn2 T C 5: 45,460,198 I137T possibly damaging Het
Cntln T C 4: 84,884,579 S39P probably damaging Het
Crocc2 T A 1: 93,215,631 N1318K probably benign Het
Emc1 C T 4: 139,371,665 Q820* probably null Het
Fam71e2 A G 7: 4,759,359 V257A probably benign Het
Fbxl2 G A 9: 113,989,383 T170I probably damaging Het
Fyb2 A G 4: 104,995,778 T552A probably damaging Het
Gm2381 G A 7: 42,820,586 A38V probably benign Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Helz2 C T 2: 181,233,467 E1745K probably damaging Het
Hspg2 T C 4: 137,541,695 Y2213H probably damaging Het
Ifnar2 T C 16: 91,388,098 Y24H possibly damaging Het
Inpp5d T A 1: 87,699,675 L566Q probably damaging Het
Itgb2 C A 10: 77,548,597 P184H probably damaging Het
Kcnb2 T A 1: 15,711,212 D769E probably benign Het
Lrp1b A G 2: 40,851,654 M3087T possibly damaging Het
Ltbp3 A G 19: 5,745,772 probably null Het
Ms4a6b A G 19: 11,520,364 E9G probably damaging Het
Nat3 G A 8: 67,524,179 probably null Het
Ndufaf1 A T 2: 119,660,053 D175E probably damaging Het
Nop58 T G 1: 59,711,312 probably benign Het
Olfr122 A G 17: 37,772,435 T261A probably benign Het
Olfr285 A G 15: 98,313,338 Y71H possibly damaging Het
P3h4 C T 11: 100,411,749 E354K probably benign Het
Plekhm2 T G 4: 141,629,532 T787P possibly damaging Het
Ppia C T 11: 6,418,230 T37I probably benign Het
Reln T A 5: 21,995,513 M1330L probably benign Het
Ric1 A G 19: 29,562,026 E53G probably benign Het
Sgip1 T A 4: 102,966,285 V721E probably damaging Het
Slc33a1 A T 3: 63,943,288 D538E probably benign Het
Son T C 16: 91,674,741 Het
Srebf1 A T 11: 60,203,515 S591R probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Taok2 G A 7: 126,870,147 R1170W probably damaging Het
Tsc2 A T 17: 24,626,714 V210E probably benign Het
Ttc6 T A 12: 57,728,463 N1648K possibly damaging Het
Vgll3 C T 16: 65,839,245 P94L probably damaging Het
Vmn2r54 A T 7: 12,615,435 V740E probably damaging Het
Yeats2 A G 16: 20,221,710 E1127G possibly damaging Het
Zfp709 T A 8: 71,889,485 Y252N probably damaging Het
Other mutations in Cbx7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Cbx7 APN 15 79930628 missense probably damaging 1.00
IGL02601:Cbx7 APN 15 79923470 critical splice donor site probably null
IGL02798:Cbx7 APN 15 79918399 missense probably damaging 1.00
R1372:Cbx7 UTSW 15 79918873 missense probably damaging 1.00
R1373:Cbx7 UTSW 15 79918873 missense probably damaging 1.00
R1985:Cbx7 UTSW 15 79918390 missense probably damaging 1.00
R2240:Cbx7 UTSW 15 79918357 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACGCTTGAAGCAGGATGC -3'
(R):5'- CCAAGGGCAATGAGAAGCTC -3'

Sequencing Primer
(F):5'- GTGCACCTGCCTAGCTAGCTATAG -3'
(R):5'- CCATGGGGGTGGTCAAGG -3'
Posted On2018-04-27