Incidental Mutation 'R6372:Ubn1'
ID513601
Institutional Source Beutler Lab
Gene Symbol Ubn1
Ensembl Gene ENSMUSG00000039473
Gene Nameubinuclein 1
Synonyms1110029L11Rik, 2610108L02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.612) question?
Stock #R6372 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location5050057-5086289 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 5081638 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 1082 (T1082I)
Ref Sequence ENSEMBL: ENSMUSP00000155223 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035672] [ENSMUST00000052449] [ENSMUST00000229126] [ENSMUST00000230703]
Predicted Effect probably benign
Transcript: ENSMUST00000035672
SMART Domains Protein: ENSMUSP00000039360
Gene: ENSMUSG00000039457

DomainStartEndE-ValueType
SPEC 123 211 1.58e0 SMART
SPEC 214 315 3.38e-2 SMART
SPEC 321 483 1.11e-2 SMART
SPEC 503 610 4.96e0 SMART
Blast:SPEC 613 717 5e-59 BLAST
low complexity region 718 729 N/A INTRINSIC
Blast:SPEC 732 859 2e-60 BLAST
low complexity region 893 908 N/A INTRINSIC
low complexity region 963 982 N/A INTRINSIC
internal_repeat_2 984 1004 3.46e-5 PROSPERO
internal_repeat_1 992 1008 8.09e-7 PROSPERO
low complexity region 1011 1020 N/A INTRINSIC
low complexity region 1027 1042 N/A INTRINSIC
internal_repeat_1 1112 1128 8.09e-7 PROSPERO
coiled coil region 1180 1279 N/A INTRINSIC
low complexity region 1346 1355 N/A INTRINSIC
low complexity region 1386 1433 N/A INTRINSIC
low complexity region 1455 1479 N/A INTRINSIC
Blast:SPEC 1529 1610 8e-30 BLAST
low complexity region 1612 1630 N/A INTRINSIC
PLEC 1649 1683 1.34e-5 SMART
PLEC 1698 1733 2.23e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000052449
AA Change: T1082I

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000061843
Gene: ENSMUSG00000039473
AA Change: T1082I

DomainStartEndE-ValueType
Pfam:HUN 117 168 1.4e-22 PFAM
low complexity region 181 224 N/A INTRINSIC
low complexity region 232 238 N/A INTRINSIC
low complexity region 250 267 N/A INTRINSIC
low complexity region 331 344 N/A INTRINSIC
Pfam:UBN_AB 353 573 2.4e-80 PFAM
low complexity region 792 804 N/A INTRINSIC
low complexity region 856 882 N/A INTRINSIC
low complexity region 905 934 N/A INTRINSIC
low complexity region 970 984 N/A INTRINSIC
low complexity region 996 1006 N/A INTRINSIC
low complexity region 1016 1034 N/A INTRINSIC
low complexity region 1084 1098 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000229126
AA Change: T1082I

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229355
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229386
Predicted Effect possibly damaging
Transcript: ENSMUST00000230703
AA Change: T1082I

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
Meta Mutation Damage Score 0.0676 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cellular senescence is a hallmark of tumor suppression and tissue aging. Senescent cells contain domains of heterochromatin, called senescence-associated heterochromatin foci (SAHF), that repress proliferation-promoting genes. The protein encoded by this gene binds to proliferation-promoting genes and is required for SAHF formation, enhancing methylation of histone H3. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T A 10: 87,230,226 H136Q possibly damaging Het
3110035E14Rik G A 1: 9,613,321 E45K probably damaging Het
Aim2 T A 1: 173,455,236 probably null Het
Atp13a3 T C 16: 30,343,455 H696R probably damaging Het
Atrnl1 T C 19: 57,650,332 S301P probably benign Het
Atxn1 T A 13: 45,557,456 I667F probably damaging Het
Cacnb4 T A 2: 52,434,667 Y415F probably benign Het
Ccdc183 T C 2: 25,616,164 D140G probably benign Het
Clec2g A C 6: 128,948,763 H45P probably benign Het
Col5a3 A G 9: 20,785,586 V917A probably damaging Het
Cryga T C 1: 65,103,045 Y63C probably damaging Het
Dnajc28 T C 16: 91,617,288 I23V probably benign Het
Elovl6 T C 3: 129,633,102 F139S probably damaging Het
Fcgbp A G 7: 28,107,008 T2134A probably damaging Het
Fcrl5 C T 3: 87,444,194 Q250* probably null Het
Gimap1 T A 6: 48,743,356 *301K probably null Het
Gm17472 T C 6: 42,980,889 S31P possibly damaging Het
Gm2381 G A 7: 42,820,586 A38V probably benign Het
Gnl1 T C 17: 35,982,535 F204S probably damaging Het
Helz2 C T 2: 181,233,467 E1745K probably damaging Het
Hk1 T C 10: 62,291,978 H370R probably benign Het
Ighv7-2 G A 12: 113,912,455 T10I probably benign Het
Itga9 A G 9: 118,897,321 K448E probably damaging Het
Lama4 C A 10: 39,067,952 N750K probably benign Het
Megf11 T C 9: 64,706,625 Y1077H probably damaging Het
Mrpl45 T C 11: 97,321,562 probably benign Het
Nbeal2 T C 9: 110,628,744 D2185G possibly damaging Het
Ncoa3 C T 2: 166,059,347 S953F possibly damaging Het
Nlrc5 T C 8: 94,479,750 L743P probably damaging Het
Nol4 A G 18: 23,038,556 probably null Het
Nol9 T C 4: 152,045,995 S329P probably damaging Het
Ntrk1 T C 3: 87,786,048 D259G probably benign Het
Olfr1039 T C 2: 86,130,854 T270A possibly damaging Het
Olfr1098 T A 2: 86,923,155 I126F probably damaging Het
Olfr1155 T C 2: 87,942,975 T218A probably benign Het
Olfr1286 T A 2: 111,420,802 I50F probably benign Het
Olfr1381 A G 11: 49,551,930 Y61C probably damaging Het
Pbx4 C A 8: 69,872,044 A365E possibly damaging Het
Pcdhb19 T A 18: 37,497,366 N71K probably benign Het
Pde2a G A 7: 101,481,392 A80T probably benign Het
Psmb5 C A 14: 54,616,673 R116L probably damaging Het
Recql A G 6: 142,376,840 V112A probably damaging Het
Rhbdl3 C A 11: 80,330,656 L207I probably damaging Het
Rtkn A G 6: 83,151,901 D459G possibly damaging Het
Rubcnl C A 14: 75,047,569 S509R probably damaging Het
Slc26a8 T C 17: 28,644,803 T661A probably benign Het
Sspo A T 6: 48,472,541 D2472V probably damaging Het
Taf4b T G 18: 14,804,733 V258G probably damaging Het
Tbc1d19 T G 5: 53,856,910 S293R possibly damaging Het
Tecpr1 C T 5: 144,216,958 R159Q probably damaging Het
Tlr3 A G 8: 45,397,011 S874P probably damaging Het
Tnk2 T A 16: 32,679,785 W639R probably damaging Het
Tpmt C T 13: 47,035,894 probably null Het
Trappc9 T A 15: 72,590,074 D935V possibly damaging Het
Trav13-4-dv7 T C 14: 53,757,661 V4A probably damaging Het
Usf2 G A 7: 30,955,313 Q35* probably null Het
Vmn1r57 T C 7: 5,220,827 M117T possibly damaging Het
Vmn2r65 G T 7: 84,940,653 A685E probably damaging Het
Zeb2 T C 2: 45,002,539 E166G probably damaging Het
Zfp808 T C 13: 62,172,477 S507P probably damaging Het
Other mutations in Ubn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Ubn1 APN 16 5081914 missense probably benign 0.00
IGL01726:Ubn1 APN 16 5073470 critical splice donor site probably null
IGL01744:Ubn1 APN 16 5072059 missense probably damaging 1.00
IGL01777:Ubn1 APN 16 5072149 missense possibly damaging 0.46
IGL02110:Ubn1 APN 16 5081890 splice site probably benign
IGL02667:Ubn1 APN 16 5062599 missense probably damaging 1.00
IGL03345:Ubn1 APN 16 5081964 missense probably damaging 0.98
R0201:Ubn1 UTSW 16 5064614 missense probably damaging 1.00
R0437:Ubn1 UTSW 16 5072184 critical splice donor site probably benign
R0514:Ubn1 UTSW 16 5073071 missense probably damaging 1.00
R0550:Ubn1 UTSW 16 5062620 unclassified probably null
R0919:Ubn1 UTSW 16 5064391 missense probably damaging 1.00
R1183:Ubn1 UTSW 16 5064542 missense probably damaging 1.00
R1339:Ubn1 UTSW 16 5055335 missense probably damaging 0.99
R1440:Ubn1 UTSW 16 5077294 missense probably damaging 1.00
R1836:Ubn1 UTSW 16 5077391 missense probably benign
R2024:Ubn1 UTSW 16 5064623 missense probably damaging 1.00
R2026:Ubn1 UTSW 16 5064650 missense probably damaging 1.00
R2105:Ubn1 UTSW 16 5077224 nonsense probably null
R2896:Ubn1 UTSW 16 5055219 missense possibly damaging 0.60
R3418:Ubn1 UTSW 16 5074379 splice site probably benign
R3721:Ubn1 UTSW 16 5073378 missense possibly damaging 0.59
R4033:Ubn1 UTSW 16 5064611 missense probably damaging 1.00
R4398:Ubn1 UTSW 16 5064425 missense probably damaging 0.99
R4547:Ubn1 UTSW 16 5072092 missense probably damaging 1.00
R4646:Ubn1 UTSW 16 5077987 missense probably damaging 0.99
R4870:Ubn1 UTSW 16 5077313 missense probably damaging 1.00
R5018:Ubn1 UTSW 16 5063725 missense probably damaging 1.00
R5220:Ubn1 UTSW 16 5077954 missense probably benign 0.02
R5394:Ubn1 UTSW 16 5074369 missense possibly damaging 0.51
R6217:Ubn1 UTSW 16 5077232 missense probably damaging 1.00
R6418:Ubn1 UTSW 16 5081927 missense probably benign
R6823:Ubn1 UTSW 16 5064547 missense probably damaging 1.00
R7028:Ubn1 UTSW 16 5055324 missense probably damaging 1.00
X0067:Ubn1 UTSW 16 5055338 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TTTCCTCCCCAGAAAGGAACTG -3'
(R):5'- TTTGGGAGATCTAGAGCCCCAG -3'

Sequencing Primer
(F):5'- AGTGCTGCTGTCCAACAC -3'
(R):5'- CAGGCAACCTGCAGACCAG -3'
Posted On2018-04-27