Incidental Mutation 'R6373:Spink5'
ID513647
Institutional Source Beutler Lab
Gene Symbol Spink5
Ensembl Gene ENSMUSG00000055561
Gene Nameserine peptidase inhibitor, Kazal type 5
Synonyms2310065D10Rik, LEKT1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6373 (G1)
Quality Score207.009
Status Validated
Chromosome18
Chromosomal Location43963235-44022501 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43990672 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 342 (E342G)
Ref Sequence ENSEMBL: ENSMUSP00000066214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069245]
Predicted Effect probably damaging
Transcript: ENSMUST00000069245
AA Change: E342G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066214
Gene: ENSMUSG00000055561
AA Change: E342G

DomainStartEndE-ValueType
PDB:1UUC|A 26 77 3e-6 PDB
KAZAL 97 152 1.67e-15 SMART
KAZAL 161 216 2.07e-3 SMART
KAZAL 226 281 3.37e-11 SMART
KAZAL 298 353 2.92e-6 SMART
KAZAL 367 424 6.73e-3 SMART
KAZAL 426 480 6.07e-4 SMART
KAZAL 496 558 2.43e-1 SMART
KAZAL 559 614 2.72e-15 SMART
KAZAL 633 687 1.95e-7 SMART
KAZAL 700 755 1.01e-9 SMART
KAZAL 769 824 7.29e-7 SMART
KAZAL 865 931 1.32e-4 SMART
KAZAL 942 996 2.74e-11 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 95% (37/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multidomain serine protease inhibitor that contains 15 potential inhibitory domains. The encoded preproprotein is proteolytically processed to generate multiple protein products, which may exhibit unique activities and specificities. These proteins may play a role in skin and hair morphogenesis, as well as anti-inflammatory and antimicrobial protection of mucous epithelia. Mutations in this gene may result in Netherton syndrome, a disorder characterized by ichthyosis, defective cornification, and atopy. This gene is present in a gene cluster on chromosome 5. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutant mice display neonatal lethality, exfoliative erythroderma, and severe dehydration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd13 T C 8: 9,988,240 L279P probably damaging Het
Aldh16a1 C G 7: 45,146,271 V373L probably benign Het
Btn2a2 T C 13: 23,481,829 K278E probably benign Het
Carns1 G T 19: 4,166,516 Q556K probably benign Het
Chd1 A T 17: 15,738,636 E650V probably damaging Het
Cobl A G 11: 12,253,118 S1195P probably damaging Het
Ddx58 A G 4: 40,216,487 Y504H possibly damaging Het
Deup1 T C 9: 15,561,342 H464R probably damaging Het
Eva1a T C 6: 82,091,866 L58S probably damaging Het
Fign A C 2: 63,979,645 M427R probably benign Het
Gm6309 A T 5: 146,170,275 I87N probably damaging Het
Gm7879 A G 5: 43,913,551 T127A probably damaging Het
Helz A G 11: 107,595,184 T140A probably benign Het
Helz2 C T 2: 181,233,467 E1745K probably damaging Het
Hist1h2ad A G 13: 23,574,853 K128R probably benign Het
Kif16b A T 2: 142,699,698 H1227Q possibly damaging Het
Mab21l1 A T 3: 55,783,084 I31F possibly damaging Het
Mex3c T C 18: 73,589,994 M386T probably benign Het
Myh11 T A 16: 14,205,130 I1644F possibly damaging Het
Nav2 C T 7: 49,453,175 P513S probably damaging Het
Ncoa3 C T 2: 166,059,347 S953F possibly damaging Het
Nmt2 A G 2: 3,324,951 T462A probably benign Het
Nrxn2 T C 19: 6,509,830 I163T probably damaging Het
Nrxn3 G C 12: 89,976,469 G122R probably damaging Het
Olfr1165-ps T C 2: 88,101,845 I47M possibly damaging Het
Olfr385 A G 11: 73,588,898 V280A probably benign Het
Parg T G 14: 32,209,497 probably null Het
Pcdhb7 T A 18: 37,342,211 C133* probably null Het
Rpe T C 1: 66,715,980 F174L probably benign Het
Rxrb A G 17: 34,033,559 N40S probably benign Het
Ryr3 C A 2: 112,656,544 G3840W probably damaging Het
Smurf2 A G 11: 106,833,769 L529P probably damaging Het
Sntg2 C T 12: 30,258,041 R215H probably benign Het
Spata20 A G 11: 94,483,400 V348A probably benign Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Syce1l T A 8: 113,649,511 M31K probably benign Het
Ttn C T 2: 76,788,616 V14394I probably damaging Het
Twnk G A 19: 45,009,381 V450M probably damaging Het
Vangl1 T C 3: 102,158,448 K407R probably benign Het
Vmn1r19 T C 6: 57,405,332 I290T unknown Het
Other mutations in Spink5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Spink5 APN 18 43987871 splice site probably benign
IGL00332:Spink5 APN 18 43967044 missense probably benign 0.00
IGL00501:Spink5 APN 18 43977739 missense probably damaging 0.98
IGL00772:Spink5 APN 18 44006420 missense probably benign 0.02
IGL00920:Spink5 APN 18 44003209 missense probably damaging 1.00
IGL00980:Spink5 APN 18 44007710 missense probably damaging 1.00
IGL01016:Spink5 APN 18 44007644 missense probably damaging 1.00
IGL01155:Spink5 APN 18 43981147 missense probably benign 0.01
IGL01374:Spink5 APN 18 43989404 missense possibly damaging 0.74
IGL01629:Spink5 APN 18 43996610 splice site probably benign
IGL01907:Spink5 APN 18 43996676 missense probably damaging 1.00
IGL01931:Spink5 APN 18 44015638 missense probably benign 0.02
IGL02237:Spink5 APN 18 44012867 missense probably benign 0.03
IGL02306:Spink5 APN 18 43964444 missense probably damaging 0.98
IGL02402:Spink5 APN 18 43967104 missense probably damaging 1.00
IGL02425:Spink5 APN 18 43990744 critical splice donor site probably null
IGL02552:Spink5 APN 18 43992168 missense possibly damaging 0.80
IGL02554:Spink5 APN 18 44015594 missense probably benign 0.01
IGL03066:Spink5 APN 18 44016390 missense probably damaging 1.00
IGL03288:Spink5 APN 18 44014760 missense possibly damaging 0.59
crusty2 UTSW 18 43999935 splice site probably benign
R0079:Spink5 UTSW 18 43977764 missense probably damaging 1.00
R0184:Spink5 UTSW 18 44003198 missense probably benign 0.00
R0452:Spink5 UTSW 18 43963318 missense possibly damaging 0.74
R0569:Spink5 UTSW 18 43989419 missense probably damaging 1.00
R0639:Spink5 UTSW 18 44012975 splice site probably null
R0648:Spink5 UTSW 18 43999797 splice site probably benign
R0705:Spink5 UTSW 18 43992274 missense probably benign 0.01
R1170:Spink5 UTSW 18 43983563 missense probably benign 0.07
R1290:Spink5 UTSW 18 44007711 missense probably damaging 0.99
R1345:Spink5 UTSW 18 43990682 missense possibly damaging 0.88
R1458:Spink5 UTSW 18 44007719 missense probably benign 0.01
R1530:Spink5 UTSW 18 44015671 missense probably damaging 0.96
R1570:Spink5 UTSW 18 43967107 missense probably benign 0.00
R1820:Spink5 UTSW 18 43989419 missense possibly damaging 0.94
R1843:Spink5 UTSW 18 43999891 missense probably benign 0.03
R1968:Spink5 UTSW 18 43990708 missense probably benign 0.06
R2050:Spink5 UTSW 18 44007758 critical splice donor site probably null
R2252:Spink5 UTSW 18 44020824 nonsense probably null
R2278:Spink5 UTSW 18 43986329 missense probably benign 0.07
R2279:Spink5 UTSW 18 43986329 missense probably benign 0.07
R2696:Spink5 UTSW 18 43982292 missense probably damaging 1.00
R2992:Spink5 UTSW 18 43996629 missense probably damaging 1.00
R3422:Spink5 UTSW 18 44010244 missense probably benign 0.01
R3934:Spink5 UTSW 18 44016427 missense probably damaging 1.00
R4179:Spink5 UTSW 18 43987867 missense probably benign
R4854:Spink5 UTSW 18 44020841 makesense probably null
R5011:Spink5 UTSW 18 44006412 missense probably damaging 0.97
R5133:Spink5 UTSW 18 43986423 missense probably damaging 1.00
R5163:Spink5 UTSW 18 43999857 missense possibly damaging 0.95
R5185:Spink5 UTSW 18 44015644 missense probably damaging 0.97
R5187:Spink5 UTSW 18 43989451 missense probably damaging 1.00
R5292:Spink5 UTSW 18 44006454 missense probably benign
R5332:Spink5 UTSW 18 43992917 missense possibly damaging 0.89
R5600:Spink5 UTSW 18 44018711 missense probably damaging 0.96
R6267:Spink5 UTSW 18 44014757 missense probably damaging 0.99
R6296:Spink5 UTSW 18 44014757 missense probably damaging 0.99
R6982:Spink5 UTSW 18 43977725 missense probably damaging 1.00
R6982:Spink5 UTSW 18 44010042 splice site probably null
R7332:Spink5 UTSW 18 43982250 missense probably damaging 0.96
R7396:Spink5 UTSW 18 43977655 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ATGTCATAGGATGTCAGCTTATTGG -3'
(R):5'- GTCTCTTAACAGGAAGAATGAATCCG -3'

Sequencing Primer
(F):5'- ATAGGATGTCAGCTTATTGGAAGTAG -3'
(R):5'- TGAATCCGTTTCATACAATGCTC -3'
Posted On2018-04-27