Incidental Mutation 'R6374:Tex15'
ID513693
Institutional Source Beutler Lab
Gene Symbol Tex15
Ensembl Gene ENSMUSG00000009628
Gene Nametestis expressed gene 15
Synonyms2210014E14Rik
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_031374.2; MGI: 1934816

Is this an essential gene? Possibly essential (E-score: 0.515) question?
Stock #R6374 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location33516738-33585582 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33575912 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1790 (E1790G)
Ref Sequence ENSEMBL: ENSMUSP00000009772 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009772] [ENSMUST00000124496] [ENSMUST00000124501]
Predicted Effect probably damaging
Transcript: ENSMUST00000009772
AA Change: E1790G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000009772
Gene: ENSMUSG00000009628
AA Change: E1790G

DomainStartEndE-ValueType
low complexity region 262 274 N/A INTRINSIC
low complexity region 302 313 N/A INTRINSIC
low complexity region 524 536 N/A INTRINSIC
low complexity region 665 674 N/A INTRINSIC
low complexity region 713 725 N/A INTRINSIC
low complexity region 946 961 N/A INTRINSIC
low complexity region 1497 1508 N/A INTRINSIC
Pfam:TEX15 1572 1788 1.3e-109 PFAM
Pfam:TEX15 1901 2119 1.1e-16 PFAM
low complexity region 2758 2770 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124496
SMART Domains Protein: ENSMUSP00000120744
Gene: ENSMUSG00000009628

DomainStartEndE-ValueType
Pfam:DUF3715 89 251 1.6e-58 PFAM
low complexity region 536 548 N/A INTRINSIC
low complexity region 576 587 N/A INTRINSIC
low complexity region 798 810 N/A INTRINSIC
low complexity region 939 948 N/A INTRINSIC
low complexity region 987 999 N/A INTRINSIC
low complexity region 1220 1235 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124501
SMART Domains Protein: ENSMUSP00000138070
Gene: ENSMUSG00000009628

DomainStartEndE-ValueType
Pfam:DUF3715 96 251 2.4e-52 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.4%
Validation Efficiency 99% (75/76)
MGI Phenotype Strain: 3526165
PHENOTYPE: Male mice are infertile due to arrest of meiosis stemming from failure to repair double-strand breaks. However, female mice are fertile. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A C 2: 151,472,880 S293A possibly damaging Het
4932415D10Rik T A 10: 82,288,897 probably benign Het
5430401F13Rik A T 6: 131,552,929 Q162L unknown Het
Abca8a A T 11: 110,083,390 Y239* probably null Het
Aox3 T C 1: 58,172,161 I959T probably benign Het
Atad2b T C 12: 5,018,002 V1000A probably damaging Het
Atic C T 1: 71,564,941 T221M probably damaging Het
Atp1a2 C T 1: 172,289,375 R225H probably damaging Het
BC024139 A G 15: 76,120,457 probably null Het
Bpi A T 2: 158,272,054 T291S probably damaging Het
Ccdc170 C T 10: 4,549,746 Q556* probably null Het
Cd3e G A 9: 45,009,363 L12F probably benign Het
Cdc42ep1 A T 15: 78,847,449 R31S probably damaging Het
Cyp21a1 G T 17: 34,804,136 probably null Het
Dnase1l3 A G 14: 7,974,115 M192T probably damaging Het
Dnmt1 A T 9: 20,924,045 H330Q possibly damaging Het
Enah T C 1: 181,923,580 E232G unknown Het
Etnppl C T 3: 130,620,693 T73I probably damaging Het
Fam83b T A 9: 76,492,907 I305F probably benign Het
Galnt15 T A 14: 32,058,159 I471N probably damaging Het
Gm19965 T A 1: 116,822,291 N567K probably benign Het
Golga1 T C 2: 39,034,068 Q435R probably benign Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Hao1 T G 2: 134,523,104 D201A probably benign Het
Heg1 T C 16: 33,727,129 L786P possibly damaging Het
Hnrnpll A T 17: 80,049,874 C238S possibly damaging Het
Hrg A G 16: 22,960,992 Y340C probably damaging Het
Kyat3 A T 3: 142,738,237 I411F probably damaging Het
Myo1a T C 10: 127,707,680 Y202H probably damaging Het
Nags T C 11: 102,146,511 C143R possibly damaging Het
Ncoa6 T C 2: 155,421,156 N453D probably damaging Het
Nup35 G T 2: 80,658,386 M322I probably benign Het
Olfr620 A G 7: 103,611,921 L144P probably benign Het
Oprl1 T C 2: 181,715,928 V69A probably damaging Het
Pappa2 T A 1: 158,956,645 Y265F probably damaging Het
Pcsk6 C T 7: 65,980,155 P343L possibly damaging Het
Peak1 C A 9: 56,257,666 D993Y probably damaging Het
Polr2a T C 11: 69,736,932 Y1383C probably damaging Het
Ppme1 A G 7: 100,341,065 S226P probably damaging Het
Prom1 C T 5: 44,055,983 C127Y probably damaging Het
Ptpn6 A T 6: 124,732,569 probably null Het
Reln T C 5: 22,080,714 E419G probably benign Het
Rnf32 C T 5: 29,225,268 Q362* probably null Het
Sbspon T C 1: 15,883,663 D131G probably benign Het
Scyl3 T C 1: 163,949,214 S392P probably benign Het
Shtn1 T A 19: 59,038,296 D121V possibly damaging Het
Sin3a A G 9: 57,117,481 T1042A probably benign Het
Sipa1l2 A T 8: 125,444,630 V1371D probably damaging Het
Slc20a2 T C 8: 22,565,652 V584A possibly damaging Het
Smc6 T A 12: 11,305,873 probably null Het
Specc1 C T 11: 62,156,592 T849I possibly damaging Het
Spta1 T A 1: 174,214,168 L1368H probably damaging Het
Sqle A G 15: 59,316,110 E89G possibly damaging Het
Strbp A G 2: 37,603,008 V422A probably damaging Het
Sult6b1 G T 17: 78,906,931 T21K probably benign Het
Tmem88b T A 4: 155,785,764 probably benign Het
Traf3ip3 T C 1: 193,182,010 D355G possibly damaging Het
Trim24 T A 6: 37,953,549 V576E probably benign Het
Trim30c C T 7: 104,390,402 G62D probably benign Het
Trim66 T G 7: 109,486,062 K100N probably benign Het
Tsnaxip1 A T 8: 105,841,540 T313S possibly damaging Het
Ugt2b37 A T 5: 87,242,420 I389N probably damaging Het
Unc13a C T 8: 71,641,453 V1335M possibly damaging Het
Urah A G 7: 140,835,211 T5A probably benign Het
Usp34 T C 11: 23,438,914 Y2185H probably damaging Het
Usp44 T C 10: 93,856,310 S643P probably benign Het
Vars2 A G 17: 35,660,045 V631A probably damaging Het
Vmn2r11 G A 5: 109,053,813 T275I possibly damaging Het
Vmn2r54 C A 7: 12,615,493 V721F probably damaging Het
Vmn2r79 T C 7: 87,002,290 I299T probably benign Het
Vps13d T C 4: 145,122,681 T2387A probably damaging Het
Washc5 A T 15: 59,337,195 L610Q probably benign Het
Zbtb21 T C 16: 97,950,368 E905G probably damaging Het
Zfhx4 A G 3: 5,244,035 T774A probably damaging Het
Zfp534 T C 4: 147,674,842 I457V probably benign Het
Zfp964 T C 8: 69,659,344 Y29H possibly damaging Het
Znrf4 A G 17: 56,511,702 F202L probably damaging Het
Other mutations in Tex15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Tex15 APN 8 33575311 missense probably benign 0.18
IGL00705:Tex15 APN 8 33581592 missense probably damaging 1.00
IGL00820:Tex15 APN 8 33579006 splice site probably benign
IGL01288:Tex15 APN 8 33571384 missense probably benign 0.02
IGL01328:Tex15 APN 8 33571396 nonsense probably null
IGL01359:Tex15 APN 8 33581898 missense probably damaging 0.99
IGL01603:Tex15 APN 8 33573547 missense possibly damaging 0.93
IGL01861:Tex15 APN 8 33570689 missense probably damaging 1.00
IGL02052:Tex15 APN 8 33582465 missense probably benign 0.28
IGL02560:Tex15 APN 8 33581751 missense probably benign 0.00
IGL02677:Tex15 APN 8 33571080 missense probably benign 0.03
IGL02739:Tex15 APN 8 33581693 missense possibly damaging 0.68
Big_gulp UTSW 8 33581734 missense probably damaging 1.00
P0005:Tex15 UTSW 8 33570868 missense probably benign 0.00
P0037:Tex15 UTSW 8 33581580 missense probably benign 0.00
PIT4377001:Tex15 UTSW 8 33571101 missense probably damaging 1.00
R0056:Tex15 UTSW 8 33582027 missense probably benign 0.00
R0056:Tex15 UTSW 8 33582027 missense probably benign 0.00
R0058:Tex15 UTSW 8 33581502 splice site probably benign
R0058:Tex15 UTSW 8 33581502 splice site probably benign
R0595:Tex15 UTSW 8 33572617 missense probably damaging 1.00
R0646:Tex15 UTSW 8 33582326 missense possibly damaging 0.83
R0688:Tex15 UTSW 8 33573500 missense probably damaging 1.00
R0842:Tex15 UTSW 8 33571547 missense possibly damaging 0.95
R0987:Tex15 UTSW 8 33576847 missense probably damaging 1.00
R1084:Tex15 UTSW 8 33577004 missense probably benign 0.28
R1183:Tex15 UTSW 8 33574865 missense probably benign 0.35
R1186:Tex15 UTSW 8 33571633 missense probably benign 0.19
R1378:Tex15 UTSW 8 33575216 missense probably damaging 0.99
R1500:Tex15 UTSW 8 33575092 missense probably damaging 0.96
R1508:Tex15 UTSW 8 33576852 missense probably damaging 1.00
R1597:Tex15 UTSW 8 33571483 missense probably damaging 0.96
R1636:Tex15 UTSW 8 33576387 nonsense probably null
R1639:Tex15 UTSW 8 33570817 missense possibly damaging 0.94
R1809:Tex15 UTSW 8 33574234 missense probably benign
R1843:Tex15 UTSW 8 33576654 missense probably benign 0.27
R2029:Tex15 UTSW 8 33571274 missense probably damaging 0.99
R2228:Tex15 UTSW 8 33571237 missense probably benign 0.05
R2229:Tex15 UTSW 8 33571237 missense probably benign 0.05
R2245:Tex15 UTSW 8 33571496 missense possibly damaging 0.77
R2246:Tex15 UTSW 8 33582512 missense possibly damaging 0.49
R2880:Tex15 UTSW 8 33574907 nonsense probably null
R2881:Tex15 UTSW 8 33574907 nonsense probably null
R2882:Tex15 UTSW 8 33574907 nonsense probably null
R3001:Tex15 UTSW 8 33574528 missense probably benign 0.15
R3002:Tex15 UTSW 8 33574528 missense probably benign 0.15
R3020:Tex15 UTSW 8 33576670 missense probably damaging 1.00
R3084:Tex15 UTSW 8 33574885 missense probably benign 0.11
R3085:Tex15 UTSW 8 33574885 missense probably benign 0.11
R3701:Tex15 UTSW 8 33574166 missense probably benign 0.00
R3702:Tex15 UTSW 8 33574166 missense probably benign 0.00
R3752:Tex15 UTSW 8 33571415 missense probably benign
R4162:Tex15 UTSW 8 33581558 missense probably damaging 1.00
R4231:Tex15 UTSW 8 33572137 missense probably damaging 0.99
R4589:Tex15 UTSW 8 33557373 missense probably damaging 1.00
R4707:Tex15 UTSW 8 33582497 missense probably benign 0.00
R4773:Tex15 UTSW 8 33582732 missense probably benign 0.42
R4967:Tex15 UTSW 8 33574470 missense probably benign 0.34
R5063:Tex15 UTSW 8 33582610 missense possibly damaging 0.59
R5121:Tex15 UTSW 8 33571766 missense probably damaging 1.00
R5147:Tex15 UTSW 8 33572312 nonsense probably null
R5166:Tex15 UTSW 8 33576392 missense probably benign 0.07
R5173:Tex15 UTSW 8 33571740 missense possibly damaging 0.73
R5439:Tex15 UTSW 8 33574171 missense possibly damaging 0.93
R5537:Tex15 UTSW 8 33571613 missense probably damaging 1.00
R5580:Tex15 UTSW 8 33572429 missense probably damaging 1.00
R5588:Tex15 UTSW 8 33577187 missense probably damaging 1.00
R5696:Tex15 UTSW 8 33573192 missense probably benign 0.01
R5734:Tex15 UTSW 8 33546336 missense probably benign 0.01
R5756:Tex15 UTSW 8 33575833 missense probably benign 0.17
R5823:Tex15 UTSW 8 33570934 missense possibly damaging 0.67
R6126:Tex15 UTSW 8 33573563 missense probably benign 0.19
R6129:Tex15 UTSW 8 33574130 missense possibly damaging 0.90
R6276:Tex15 UTSW 8 33577189 missense possibly damaging 0.93
R6430:Tex15 UTSW 8 33571301 missense probably benign 0.01
R6452:Tex15 UTSW 8 33572816 missense probably damaging 1.00
R6471:Tex15 UTSW 8 33581734 missense probably damaging 1.00
R6700:Tex15 UTSW 8 33574889 missense possibly damaging 0.93
R6918:Tex15 UTSW 8 33573184 missense probably benign 0.27
R6958:Tex15 UTSW 8 33570871 missense probably benign 0.01
R6970:Tex15 UTSW 8 33557428 missense probably benign 0.03
R7059:Tex15 UTSW 8 33574730 missense possibly damaging 0.57
R7069:Tex15 UTSW 8 33570720 missense probably benign
R7072:Tex15 UTSW 8 33575431 missense possibly damaging 0.85
X0020:Tex15 UTSW 8 33576579 missense probably benign 0.03
X0065:Tex15 UTSW 8 33575517 nonsense probably null
Z1088:Tex15 UTSW 8 33571315 missense possibly damaging 0.89
Z1088:Tex15 UTSW 8 33571810 missense possibly damaging 0.68
Z1088:Tex15 UTSW 8 33574870 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAACATTCCGAAGCTTGCTTTGG -3'
(R):5'- GGAATGGACTTTAGGAGAGCCC -3'

Sequencing Primer
(F):5'- GTATGATGAGAGCTTGTACAGTGAAC -3'
(R):5'- ACTGATCAGCTTCAGAGTGC -3'
Posted On2018-04-27