Incidental Mutation 'R6374:BC024139'
ID513718
Institutional Source Beutler Lab
Gene Symbol BC024139
Ensembl Gene ENSMUSG00000044361
Gene NamecDNA sequence BC024139
Synonyms6230424I18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R6374 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location76119517-76126596 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 76120457 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000087082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054022] [ENSMUST00000054022] [ENSMUST00000054022] [ENSMUST00000089654] [ENSMUST00000089654] [ENSMUST00000089654] [ENSMUST00000146157] [ENSMUST00000226781]
Predicted Effect probably null
Transcript: ENSMUST00000054022
SMART Domains Protein: ENSMUSP00000053305
Gene: ENSMUSG00000044361

DomainStartEndE-ValueType
low complexity region 61 79 N/A INTRINSIC
SPEC 91 177 8.82e-1 SMART
SPEC 184 283 2.74e-2 SMART
coiled coil region 314 337 N/A INTRINSIC
low complexity region 469 485 N/A INTRINSIC
Pfam:GAS2 672 701 3.9e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000054022
SMART Domains Protein: ENSMUSP00000053305
Gene: ENSMUSG00000044361

DomainStartEndE-ValueType
low complexity region 61 79 N/A INTRINSIC
SPEC 91 177 8.82e-1 SMART
SPEC 184 283 2.74e-2 SMART
coiled coil region 314 337 N/A INTRINSIC
low complexity region 469 485 N/A INTRINSIC
Pfam:GAS2 672 701 3.9e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000054022
SMART Domains Protein: ENSMUSP00000053305
Gene: ENSMUSG00000044361

DomainStartEndE-ValueType
low complexity region 61 79 N/A INTRINSIC
SPEC 91 177 8.82e-1 SMART
SPEC 184 283 2.74e-2 SMART
coiled coil region 314 337 N/A INTRINSIC
low complexity region 469 485 N/A INTRINSIC
Pfam:GAS2 672 701 3.9e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000089654
SMART Domains Protein: ENSMUSP00000087082
Gene: ENSMUSG00000044361

DomainStartEndE-ValueType
low complexity region 61 79 N/A INTRINSIC
SPEC 91 177 8.82e-1 SMART
SPEC 184 283 2.74e-2 SMART
coiled coil region 314 337 N/A INTRINSIC
low complexity region 469 485 N/A INTRINSIC
Pfam:GAS2 671 703 3.1e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000089654
SMART Domains Protein: ENSMUSP00000087082
Gene: ENSMUSG00000044361

DomainStartEndE-ValueType
low complexity region 61 79 N/A INTRINSIC
SPEC 91 177 8.82e-1 SMART
SPEC 184 283 2.74e-2 SMART
coiled coil region 314 337 N/A INTRINSIC
low complexity region 469 485 N/A INTRINSIC
Pfam:GAS2 671 703 3.1e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000089654
SMART Domains Protein: ENSMUSP00000087082
Gene: ENSMUSG00000044361

DomainStartEndE-ValueType
low complexity region 61 79 N/A INTRINSIC
SPEC 91 177 8.82e-1 SMART
SPEC 184 283 2.74e-2 SMART
coiled coil region 314 337 N/A INTRINSIC
low complexity region 469 485 N/A INTRINSIC
Pfam:GAS2 671 703 3.1e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126892
Predicted Effect probably benign
Transcript: ENSMUST00000146157
SMART Domains Protein: ENSMUSP00000117783
Gene: ENSMUSG00000044361

DomainStartEndE-ValueType
low complexity region 61 79 N/A INTRINSIC
SPEC 91 177 8.82e-1 SMART
SPEC 184 283 2.74e-2 SMART
coiled coil region 314 337 N/A INTRINSIC
low complexity region 469 485 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226663
Predicted Effect probably benign
Transcript: ENSMUST00000226781
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.4%
Validation Efficiency 99% (75/76)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A C 2: 151,472,880 S293A possibly damaging Het
4932415D10Rik T A 10: 82,288,897 probably benign Het
5430401F13Rik A T 6: 131,552,929 Q162L unknown Het
Abca8a A T 11: 110,083,390 Y239* probably null Het
Aox3 T C 1: 58,172,161 I959T probably benign Het
Atad2b T C 12: 5,018,002 V1000A probably damaging Het
Atic C T 1: 71,564,941 T221M probably damaging Het
Atp1a2 C T 1: 172,289,375 R225H probably damaging Het
Bpi A T 2: 158,272,054 T291S probably damaging Het
Ccdc170 C T 10: 4,549,746 Q556* probably null Het
Cd3e G A 9: 45,009,363 L12F probably benign Het
Cdc42ep1 A T 15: 78,847,449 R31S probably damaging Het
Cyp21a1 G T 17: 34,804,136 probably null Het
Dnase1l3 A G 14: 7,974,115 M192T probably damaging Het
Dnmt1 A T 9: 20,924,045 H330Q possibly damaging Het
Enah T C 1: 181,923,580 E232G unknown Het
Etnppl C T 3: 130,620,693 T73I probably damaging Het
Fam83b T A 9: 76,492,907 I305F probably benign Het
Galnt15 T A 14: 32,058,159 I471N probably damaging Het
Gm19965 T A 1: 116,822,291 N567K probably benign Het
Golga1 T C 2: 39,034,068 Q435R probably benign Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Hao1 T G 2: 134,523,104 D201A probably benign Het
Heg1 T C 16: 33,727,129 L786P possibly damaging Het
Hnrnpll A T 17: 80,049,874 C238S possibly damaging Het
Hrg A G 16: 22,960,992 Y340C probably damaging Het
Kyat3 A T 3: 142,738,237 I411F probably damaging Het
Myo1a T C 10: 127,707,680 Y202H probably damaging Het
Nags T C 11: 102,146,511 C143R possibly damaging Het
Ncoa6 T C 2: 155,421,156 N453D probably damaging Het
Nup35 G T 2: 80,658,386 M322I probably benign Het
Olfr620 A G 7: 103,611,921 L144P probably benign Het
Oprl1 T C 2: 181,715,928 V69A probably damaging Het
Pappa2 T A 1: 158,956,645 Y265F probably damaging Het
Pcsk6 C T 7: 65,980,155 P343L possibly damaging Het
Peak1 C A 9: 56,257,666 D993Y probably damaging Het
Polr2a T C 11: 69,736,932 Y1383C probably damaging Het
Ppme1 A G 7: 100,341,065 S226P probably damaging Het
Prom1 C T 5: 44,055,983 C127Y probably damaging Het
Ptpn6 A T 6: 124,732,569 probably null Het
Reln T C 5: 22,080,714 E419G probably benign Het
Rnf32 C T 5: 29,225,268 Q362* probably null Het
Sbspon T C 1: 15,883,663 D131G probably benign Het
Scyl3 T C 1: 163,949,214 S392P probably benign Het
Shtn1 T A 19: 59,038,296 D121V possibly damaging Het
Sin3a A G 9: 57,117,481 T1042A probably benign Het
Sipa1l2 A T 8: 125,444,630 V1371D probably damaging Het
Slc20a2 T C 8: 22,565,652 V584A possibly damaging Het
Smc6 T A 12: 11,305,873 probably null Het
Specc1 C T 11: 62,156,592 T849I possibly damaging Het
Spta1 T A 1: 174,214,168 L1368H probably damaging Het
Sqle A G 15: 59,316,110 E89G possibly damaging Het
Strbp A G 2: 37,603,008 V422A probably damaging Het
Sult6b1 G T 17: 78,906,931 T21K probably benign Het
Tex15 A G 8: 33,575,912 E1790G probably damaging Het
Tmem88b T A 4: 155,785,764 probably benign Het
Traf3ip3 T C 1: 193,182,010 D355G possibly damaging Het
Trim24 T A 6: 37,953,549 V576E probably benign Het
Trim30c C T 7: 104,390,402 G62D probably benign Het
Trim66 T G 7: 109,486,062 K100N probably benign Het
Tsnaxip1 A T 8: 105,841,540 T313S possibly damaging Het
Ugt2b37 A T 5: 87,242,420 I389N probably damaging Het
Unc13a C T 8: 71,641,453 V1335M possibly damaging Het
Urah A G 7: 140,835,211 T5A probably benign Het
Usp34 T C 11: 23,438,914 Y2185H probably damaging Het
Usp44 T C 10: 93,856,310 S643P probably benign Het
Vars2 A G 17: 35,660,045 V631A probably damaging Het
Vmn2r11 G A 5: 109,053,813 T275I possibly damaging Het
Vmn2r54 C A 7: 12,615,493 V721F probably damaging Het
Vmn2r79 T C 7: 87,002,290 I299T probably benign Het
Vps13d T C 4: 145,122,681 T2387A probably damaging Het
Washc5 A T 15: 59,337,195 L610Q probably benign Het
Zbtb21 T C 16: 97,950,368 E905G probably damaging Het
Zfhx4 A G 3: 5,244,035 T774A probably damaging Het
Zfp534 T C 4: 147,674,842 I457V probably benign Het
Zfp964 T C 8: 69,659,344 Y29H possibly damaging Het
Znrf4 A G 17: 56,511,702 F202L probably damaging Het
Other mutations in BC024139
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:BC024139 APN 15 76125100 missense probably benign 0.06
IGL01684:BC024139 APN 15 76124685 missense probably damaging 1.00
IGL01780:BC024139 APN 15 76121143 missense probably benign 0.01
IGL03084:BC024139 APN 15 76119807 missense probably benign 0.00
IGL03242:BC024139 APN 15 76120320 missense probably benign 0.32
IGL03386:BC024139 APN 15 76121745 missense probably benign 0.18
R0018:BC024139 UTSW 15 76120887 nonsense probably null
R0018:BC024139 UTSW 15 76120887 nonsense probably null
R0153:BC024139 UTSW 15 76121747 missense probably damaging 0.96
R0789:BC024139 UTSW 15 76121083 missense possibly damaging 0.51
R1158:BC024139 UTSW 15 76120342 unclassified probably benign
R1515:BC024139 UTSW 15 76124326 missense possibly damaging 0.83
R1840:BC024139 UTSW 15 76120642 missense probably benign
R1845:BC024139 UTSW 15 76125261 nonsense probably null
R2159:BC024139 UTSW 15 76121488 missense probably damaging 0.96
R2264:BC024139 UTSW 15 76125917 missense probably damaging 1.00
R2680:BC024139 UTSW 15 76121739 missense probably damaging 0.98
R2697:BC024139 UTSW 15 76120193 unclassified probably benign
R4113:BC024139 UTSW 15 76121627 missense probably benign 0.35
R4630:BC024139 UTSW 15 76125094 missense probably benign 0.23
R4825:BC024139 UTSW 15 76120317 missense possibly damaging 0.84
R4865:BC024139 UTSW 15 76126066 missense possibly damaging 0.56
R5208:BC024139 UTSW 15 76124665 missense probably benign 0.03
R5369:BC024139 UTSW 15 76120222 missense probably benign 0.02
R5371:BC024139 UTSW 15 76120686 makesense probably null
R5897:BC024139 UTSW 15 76126139 missense possibly damaging 0.84
R6110:BC024139 UTSW 15 76119796 missense probably benign
R6823:BC024139 UTSW 15 76119746 makesense probably null
R6915:BC024139 UTSW 15 76120021 missense probably benign
R7075:BC024139 UTSW 15 76124399 missense probably benign 0.06
X0066:BC024139 UTSW 15 76124002 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGACCAGAAATTCATCCAAAGCTG -3'
(R):5'- AGCTTCCTGTCAACTGAGGAG -3'

Sequencing Primer
(F):5'- TTCATCCAAAGCTGCCCAAC -3'
(R):5'- CTGAGGAGCAGGACAGCGTG -3'
Posted On2018-04-27