Incidental Mutation 'R6337:Hells'
ID513789
Institutional Source Beutler Lab
Gene Symbol Hells
Ensembl Gene ENSMUSG00000025001
Gene Namehelicase, lymphoid specific
SynonymsYFK8, LSH, proliferation-associated SNF2-like, PASG, Lysh, E130115I21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6337 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location38930915-38971051 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 38954810 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 519 (Q519H)
Ref Sequence ENSEMBL: ENSMUSP00000025965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025965]
Predicted Effect probably benign
Transcript: ENSMUST00000025965
AA Change: Q519H

PolyPhen 2 Score 0.153 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000025965
Gene: ENSMUSG00000025001
AA Change: Q519H

DomainStartEndE-ValueType
low complexity region 13 29 N/A INTRINSIC
Blast:DEXDc 40 144 4e-22 BLAST
DEXDc 202 394 7.04e-31 SMART
HELICc 612 695 5.6e-25 SMART
low complexity region 775 791 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127968
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155465
Meta Mutation Damage Score 0.192 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a lymphoid-specific helicase. Other helicases function in processes involving DNA strand separation, including replication, repair, recombination, and transcription. This protein is thought to be involved with cellular proliferation and may play a role in leukemogenesis. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygotes for a null allele show DNA hypomethylation, delayed growth, multiorgan and skeletal defects, premature graying, alopecia, low fat deposition, kyphosis, cachexia and early death. Homozygotes for another null allele show neonatal death, low birth weight, lymphoid defects and renal lesions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik T G 3: 90,061,733 V221G probably benign Het
Abca12 G A 1: 71,295,013 A1110V probably damaging Het
Acsl6 C A 11: 54,340,542 P462T probably damaging Het
Acsm5 G A 7: 119,534,235 A208T probably benign Het
Adcyap1 T A 17: 93,202,281 Y53* probably null Het
Adgrg7 T A 16: 56,752,425 I343F probably damaging Het
Agl T A 3: 116,786,777 K376M possibly damaging Het
Akna A G 4: 63,374,003 Y1142H probably benign Het
Anks1b A T 10: 90,921,296 T182S probably benign Het
Apol7e T A 15: 77,714,382 Y16N possibly damaging Het
Bptf G T 11: 107,058,779 T2238K possibly damaging Het
Ccdc87 A G 19: 4,839,801 E107G probably benign Het
Ccng2 C T 5: 93,270,921 A135V probably benign Het
Chd8 C A 14: 52,204,109 R842L probably damaging Het
Cldn18 T A 9: 99,709,942 T3S probably benign Het
Dhcr7 T C 7: 143,836,731 probably null Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dusp26 T C 8: 31,096,297 V182A probably damaging Het
Eif3e T C 15: 43,252,296 D358G possibly damaging Het
Epha3 A T 16: 63,568,443 L814H probably damaging Het
Flnc A G 6: 29,454,319 N1877S probably damaging Het
Fpgs A T 2: 32,687,941 Y156* probably null Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm5591 T C 7: 38,521,895 D250G probably benign Het
Gtf2e2 C T 8: 33,776,015 R240* probably null Het
Hscb A G 5: 110,839,494 probably null Het
Inpp5k T A 11: 75,646,814 I350N probably damaging Het
Irf9 G A 14: 55,606,342 V221I possibly damaging Het
Itga8 A T 2: 12,253,469 Y261* probably null Het
Lama1 C T 17: 67,786,019 T1684M probably benign Het
Lrp2 A T 2: 69,438,467 H4157Q probably damaging Het
Nceh1 G T 3: 27,222,807 R93L probably damaging Het
Nell2 A G 15: 95,385,144 F339S probably damaging Het
Olfr331 A T 11: 58,502,012 C181* probably null Het
Phf11a C A 14: 59,284,368 C118F probably damaging Het
Purg A G 8: 33,386,423 K30E possibly damaging Het
Qprt C T 7: 127,108,929 R110H probably damaging Het
Robo2 T C 16: 73,928,151 T1055A probably benign Het
Serpina3a T C 12: 104,112,878 F10L probably benign Het
Sidt1 A T 16: 44,300,935 probably null Het
Slc4a4 T A 5: 89,046,372 M237K probably benign Het
Slitrk5 A T 14: 111,680,252 D436V probably damaging Het
Snd1 T C 6: 28,888,289 Y908H probably damaging Het
Sorcs1 A G 19: 50,144,124 V1132A probably benign Het
Speer3 A G 5: 13,793,355 E92G probably damaging Het
Ssfa2 G A 2: 79,655,119 D506N probably damaging Het
Strada T C 11: 106,173,317 E58G possibly damaging Het
Tbx10 A T 19: 3,997,312 K139* probably null Het
Tcf4 T C 18: 69,633,580 Y25H probably damaging Het
Tmem108 C T 9: 103,499,761 R163H possibly damaging Het
Top2b A G 14: 16,399,026 T549A possibly damaging Het
Tpcn2 A G 7: 145,279,343 I46T probably damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Vipr2 T A 12: 116,122,743 Y129* probably null Het
Vps37a A T 8: 40,540,708 Q248L probably benign Het
Wrap53 T C 11: 69,577,685 I179V probably benign Het
Zan G A 5: 137,452,488 A1609V unknown Het
Zbtb17 G A 4: 141,463,383 G171S probably benign Het
Zbtb5 G A 4: 44,993,459 R642W probably damaging Het
Zfyve27 A G 19: 42,182,657 probably null Het
Zufsp T C 10: 33,949,256 N77D probably benign Het
Other mutations in Hells
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02416:Hells APN 19 38964627 missense probably benign
IGL02639:Hells APN 19 38938429 missense probably damaging 0.99
cerberus UTSW 19 38954800 missense probably benign 0.00
charon UTSW 19 38954810 missense probably benign 0.15
intentions UTSW 19 38957199 missense probably damaging 1.00
purgatory UTSW 19 38940635 missense probably benign 0.08
R0543:Hells UTSW 19 38967750 missense probably benign
R1432:Hells UTSW 19 38957184 splice site probably null
R1515:Hells UTSW 19 38967765 missense probably damaging 1.00
R1646:Hells UTSW 19 38967783 missense probably benign 0.19
R1779:Hells UTSW 19 38946842 missense probably benign 0.43
R1851:Hells UTSW 19 38959676 missense probably null 1.00
R1897:Hells UTSW 19 38940484 missense probably benign
R2040:Hells UTSW 19 38955030 missense probably damaging 0.98
R2571:Hells UTSW 19 38959733 missense possibly damaging 0.67
R4475:Hells UTSW 19 38945529 missense probably damaging 1.00
R4763:Hells UTSW 19 38957199 missense probably damaging 1.00
R4948:Hells UTSW 19 38935522 missense probably damaging 1.00
R5087:Hells UTSW 19 38943745 missense probably benign
R5517:Hells UTSW 19 38954800 missense probably benign 0.00
R5538:Hells UTSW 19 38953652 missense probably benign 0.00
R6107:Hells UTSW 19 38953649 missense probably benign 0.00
R6577:Hells UTSW 19 38931465 nonsense probably null
R6618:Hells UTSW 19 38957084 missense probably benign 0.17
R6647:Hells UTSW 19 38931504 missense probably benign 0.01
R6869:Hells UTSW 19 38940635 missense probably benign 0.08
R7471:Hells UTSW 19 38957057 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AACAGTCACTAGGAGGATTCATG -3'
(R):5'- TGGGTGATTACAGCACTTTCG -3'

Sequencing Primer
(F):5'- TAAACTAGGCTGGCCTTGAACTCAG -3'
(R):5'- GGTGATTACAGCACTTTCGAAGTAGC -3'
Posted On2018-04-27