Incidental Mutation 'R6339:Dync1h1'
ID513841
Institutional Source Beutler Lab
Gene Symbol Dync1h1
Ensembl Gene ENSMUSG00000018707
Gene Namedynein cytoplasmic 1 heavy chain 1
Synonyms9930018I23Rik, Dnchc1, dynein heavy chain, retrograde transport, Swl, MAP1C, Loa, Dnec1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6339 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location110601452-110666945 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 110646205 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 2838 (D2838V)
Ref Sequence ENSEMBL: ENSMUSP00000018851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018851]
PDB Structure
Microtubule binding domain from mouse cytoplasmic dynein as a fusion with seryl-tRNA synthetase [X-RAY DIFFRACTION]
High affinity dynein microtubule binding domain - tubulin complex [ELECTRON MICROSCOPY]
Low affinity dynein microtubule binding domain - tubulin complex [ELECTRON MICROSCOPY]
Structure of the entire stalk region of the dynein motor domain [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000018851
AA Change: D2838V

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000018851
Gene: ENSMUSG00000018707
AA Change: D2838V

DomainStartEndE-ValueType
low complexity region 46 61 N/A INTRINSIC
low complexity region 83 95 N/A INTRINSIC
Pfam:DHC_N1 237 830 1.9e-145 PFAM
coiled coil region 1171 1198 N/A INTRINSIC
Pfam:DHC_N2 1317 1721 3.3e-116 PFAM
AAA 1899 2043 5.39e-2 SMART
low complexity region 2102 2116 N/A INTRINSIC
AAA 2214 2365 2.13e0 SMART
low complexity region 2394 2405 N/A INTRINSIC
AAA 2585 2735 8.6e-7 SMART
Blast:AAA 2777 2811 2e-13 BLAST
AAA 2927 3093 4.79e-5 SMART
Pfam:MT 3197 3534 1.1e-44 PFAM
Pfam:AAA_9 3554 3778 8.5e-75 PFAM
Pfam:Dynein_heavy 3919 4642 4.3e-163 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172218
Meta Mutation Damage Score 0.27 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.2%
  • 20x: 94.1%
Validation Efficiency 97% (69/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are a group of microtubule-activated ATPases that function as molecular motors. They are divided into two subgroups of axonemal and cytoplasmic dyneins. The cytoplasmic dyneins function in intracellular motility, including retrograde axonal transport, protein sorting, organelle movement, and spindle dynamics. Molecules of conventional cytoplasmic dynein are comprised of 2 heavy chain polypeptides and a number of intermediate and light chains.This gene encodes a member of the cytoplasmic dynein heavy chain family. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for either the Cra1 or Loa ENU mutation exhibit neonatal lethality with reduced anterior horn cell number, abnormal motor neuron innervation, neuronal inclusions, and abnormal axonal transport. Heterozygotes display motor neuron degeneration and muscle spasms. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,682,505 D1198V probably benign Het
4933424G06Rik A T 1: 36,710,461 probably benign Het
Adgrg6 G T 10: 14,434,347 S743R probably damaging Het
Ak8 A G 2: 28,734,448 probably null Het
Alpk2 A G 18: 65,349,806 M377T probably benign Het
Ap1g1 G A 8: 109,844,368 V425I possibly damaging Het
Apob A T 12: 8,016,188 R4353W probably damaging Het
Arhgef38 T C 3: 133,133,662 K540R probably benign Het
AY761184 G A 8: 21,703,469 S45F possibly damaging Het
B3galt2 A T 1: 143,646,902 T259S possibly damaging Het
Btbd8 G A 5: 107,503,717 V159I probably benign Het
C2cd2l T C 9: 44,313,491 probably benign Het
Carmil3 T C 14: 55,499,849 V763A possibly damaging Het
Ccdc171 A T 4: 83,742,997 T1115S probably damaging Het
Chst2 C T 9: 95,405,750 G181D probably damaging Het
Col7a1 C T 9: 108,956,633 T390M unknown Het
Cpt1a A C 19: 3,362,152 D208A probably benign Het
Crocc2 A G 1: 93,214,032 E1183G probably benign Het
Dlg5 T A 14: 24,158,060 H1003L probably damaging Het
Dok2 A T 14: 70,775,718 I109L probably benign Het
Dpy19l4 A T 4: 11,285,111 I465K probably damaging Het
Frem3 A G 8: 80,613,015 R646G possibly damaging Het
Gcfc2 T A 6: 81,946,496 F514I probably damaging Het
Gm8104 T C 14: 43,101,485 M44T probably benign Het
Golph3l T A 3: 95,617,439 W334R probably damaging Het
Gpr179 A T 11: 97,344,176 F443I probably damaging Het
Ift172 A G 5: 31,256,583 V1467A probably benign Het
Ift172 A T 5: 31,286,945 D44E probably damaging Het
Il1rl1 C T 1: 40,461,856 A464V possibly damaging Het
Irx5 A G 8: 92,359,853 E188G probably damaging Het
Jak1 A G 4: 101,161,926 V710A probably damaging Het
Kcng4 A T 8: 119,632,954 F228I probably damaging Het
Lifr A G 15: 7,167,049 N238S probably benign Het
Ltbp3 C A 19: 5,747,477 H414Q probably damaging Het
Mcpt8 A G 14: 56,082,337 C219R probably benign Het
Mepce A T 5: 137,785,688 N125K possibly damaging Het
Mfap3 T C 11: 57,529,772 F193S probably damaging Het
Miox T A 15: 89,335,499 Y63* probably null Het
Msl2 A T 9: 101,101,750 H441L probably benign Het
Nemp2 T A 1: 52,640,910 S98T possibly damaging Het
Neto2 G T 8: 85,640,558 A547E probably benign Het
Nol12 T C 15: 78,940,833 probably benign Het
Npr3 T C 15: 11,845,275 I504V probably damaging Het
Olfr1204 A G 2: 88,852,871 D307G probably null Het
Pcdhb3 T C 18: 37,300,945 probably benign Het
Pear1 C A 3: 87,752,520 G720W probably damaging Het
Pibf1 T G 14: 99,107,398 D151E probably damaging Het
Pla2g6 T A 15: 79,308,816 N217I probably damaging Het
Plcd1 G A 9: 119,074,991 R292C probably damaging Het
Plcl1 C T 1: 55,696,315 L272F probably damaging Het
Ppp4r4 A T 12: 103,604,969 K656* probably null Het
Prr22 G A 17: 56,771,490 M214I probably benign Het
Ror1 G T 4: 100,411,931 R322L possibly damaging Het
Sh3tc2 G A 18: 61,975,571 W244* probably null Het
Slamf6 A G 1: 171,948,048 N320S probably null Het
Slc1a6 A C 10: 78,800,085 D328A possibly damaging Het
Sorl1 G T 9: 41,969,742 T2161K probably benign Het
Sstr2 T C 11: 113,624,549 F98S probably damaging Het
Stk33 A T 7: 109,321,465 D348E probably benign Het
Sulf1 T A 1: 12,838,440 L559Q probably damaging Het
Syne2 A G 12: 75,989,153 D3738G probably benign Het
Taok3 A T 5: 117,228,030 Q382L probably benign Het
Tet2 T A 3: 133,486,417 H752L possibly damaging Het
Tia1 A C 6: 86,426,656 K285T probably damaging Het
Tle3 G T 9: 61,401,924 probably null Het
Top1mt T C 15: 75,665,656 T414A possibly damaging Het
Ubc A T 5: 125,387,342 I307N probably damaging Het
Vmn2r96 A T 17: 18,583,862 D266V possibly damaging Het
Wbp2nl G T 15: 82,299,045 W13C possibly damaging Het
Zfp456 T A 13: 67,362,364 K102* probably null Het
Zkscan1 T C 5: 138,093,305 V100A probably damaging Het
Other mutations in Dync1h1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01291:Dync1h1 APN 12 110649104 missense probably benign 0.31
IGL01299:Dync1h1 APN 12 110614107 missense probably benign 0.04
IGL01321:Dync1h1 APN 12 110625607 splice site probably benign
IGL01324:Dync1h1 APN 12 110626865 missense probably damaging 0.99
IGL01327:Dync1h1 APN 12 110616692 splice site probably benign
IGL01371:Dync1h1 APN 12 110638851 missense probably benign 0.05
IGL01598:Dync1h1 APN 12 110658128 missense probably damaging 0.99
IGL01782:Dync1h1 APN 12 110614940 missense probably damaging 1.00
IGL01791:Dync1h1 APN 12 110658930 missense probably damaging 0.99
IGL01797:Dync1h1 APN 12 110652196 critical splice donor site probably null
IGL02040:Dync1h1 APN 12 110637124 missense probably benign 0.21
IGL02096:Dync1h1 APN 12 110632820 missense possibly damaging 0.68
IGL02164:Dync1h1 APN 12 110662559 missense probably damaging 1.00
IGL02216:Dync1h1 APN 12 110663002 missense probably damaging 0.98
IGL02298:Dync1h1 APN 12 110640888 missense probably damaging 1.00
IGL02422:Dync1h1 APN 12 110640210 missense possibly damaging 0.68
IGL02610:Dync1h1 APN 12 110659232 nonsense probably null
IGL02643:Dync1h1 APN 12 110659272 unclassified probably benign
IGL03076:Dync1h1 APN 12 110657893 missense probably damaging 1.00
IGL03292:Dync1h1 APN 12 110666555 unclassified probably null
IGL03293:Dync1h1 APN 12 110628734 missense probably benign 0.12
IGL03299:Dync1h1 APN 12 110619210 missense possibly damaging 0.49
gymnast UTSW 12 110618368 missense probably damaging 1.00
lightfoot UTSW 12 110617920 missense probably damaging 1.00
Lissom UTSW 12 110632820 missense possibly damaging 0.68
ANU05:Dync1h1 UTSW 12 110649104 missense probably benign 0.31
H8562:Dync1h1 UTSW 12 110616807 missense probably benign 0.01
R0082:Dync1h1 UTSW 12 110636446 missense probably benign
R0110:Dync1h1 UTSW 12 110639944 missense probably benign 0.42
R0130:Dync1h1 UTSW 12 110618674 missense probably benign 0.16
R0233:Dync1h1 UTSW 12 110640980 missense probably benign 0.45
R0233:Dync1h1 UTSW 12 110640980 missense probably benign 0.45
R0242:Dync1h1 UTSW 12 110649851 missense possibly damaging 0.67
R0242:Dync1h1 UTSW 12 110649851 missense possibly damaging 0.67
R0408:Dync1h1 UTSW 12 110631692 missense probably benign
R0450:Dync1h1 UTSW 12 110639944 missense probably benign 0.42
R0611:Dync1h1 UTSW 12 110632788 missense probably damaging 0.97
R0612:Dync1h1 UTSW 12 110616496 missense probably damaging 1.00
R0624:Dync1h1 UTSW 12 110651747 unclassified probably benign
R0685:Dync1h1 UTSW 12 110657192 missense probably damaging 1.00
R0747:Dync1h1 UTSW 12 110612411 missense probably benign
R0747:Dync1h1 UTSW 12 110629284 missense probably damaging 0.99
R0843:Dync1h1 UTSW 12 110665213 missense possibly damaging 0.81
R0970:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1161:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1211:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1214:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1215:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1227:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1230:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1232:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1237:Dync1h1 UTSW 12 110665959 missense probably benign 0.00
R1274:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1275:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1289:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1290:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1331:Dync1h1 UTSW 12 110649264 missense probably damaging 0.98
R1340:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1383:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1394:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1396:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1397:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1413:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1432:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1500:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1661:Dync1h1 UTSW 12 110656357 missense probably damaging 1.00
R1678:Dync1h1 UTSW 12 110665662 critical splice acceptor site probably null
R1698:Dync1h1 UTSW 12 110626992 missense possibly damaging 0.88
R1767:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1776:Dync1h1 UTSW 12 110632928 splice site probably benign
R1812:Dync1h1 UTSW 12 110662900 missense possibly damaging 0.46
R1831:Dync1h1 UTSW 12 110614059 missense probably damaging 1.00
R1832:Dync1h1 UTSW 12 110614059 missense probably damaging 1.00
R1856:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1857:Dync1h1 UTSW 12 110662625 missense probably damaging 0.96
R1879:Dync1h1 UTSW 12 110624636 missense probably benign 0.04
R1892:Dync1h1 UTSW 12 110646304 missense probably damaging 1.00
R1909:Dync1h1 UTSW 12 110662629 missense probably damaging 1.00
R1962:Dync1h1 UTSW 12 110636509 missense probably benign 0.04
R1974:Dync1h1 UTSW 12 110625732 missense possibly damaging 0.80
R1999:Dync1h1 UTSW 12 110666423 critical splice donor site probably null
R2073:Dync1h1 UTSW 12 110614592 missense probably damaging 1.00
R2091:Dync1h1 UTSW 12 110649588 missense probably benign 0.07
R2113:Dync1h1 UTSW 12 110629986 missense probably damaging 1.00
R2128:Dync1h1 UTSW 12 110640882 missense probably damaging 1.00
R2134:Dync1h1 UTSW 12 110656631 missense possibly damaging 0.68
R2496:Dync1h1 UTSW 12 110641220 missense possibly damaging 0.65
R2680:Dync1h1 UTSW 12 110643247 missense probably damaging 1.00
R2890:Dync1h1 UTSW 12 110616891 missense probably damaging 1.00
R2964:Dync1h1 UTSW 12 110641026 critical splice donor site probably null
R3705:Dync1h1 UTSW 12 110640586 missense possibly damaging 0.80
R3708:Dync1h1 UTSW 12 110643129 missense probably damaging 0.96
R3735:Dync1h1 UTSW 12 110631675 missense probably benign
R3736:Dync1h1 UTSW 12 110631675 missense probably benign
R3882:Dync1h1 UTSW 12 110629058 missense probably benign 0.41
R3971:Dync1h1 UTSW 12 110665965 missense probably benign 0.00
R4017:Dync1h1 UTSW 12 110643190 missense probably damaging 1.00
R4032:Dync1h1 UTSW 12 110618049 nonsense probably null
R4355:Dync1h1 UTSW 12 110632899 missense possibly damaging 0.55
R4514:Dync1h1 UTSW 12 110657139 missense possibly damaging 0.76
R4586:Dync1h1 UTSW 12 110649483 missense probably benign 0.30
R4619:Dync1h1 UTSW 12 110638844 missense probably benign 0.09
R4659:Dync1h1 UTSW 12 110628767 missense possibly damaging 0.50
R4676:Dync1h1 UTSW 12 110662541 missense probably damaging 0.99
R4688:Dync1h1 UTSW 12 110655528 missense probably damaging 0.99
R4732:Dync1h1 UTSW 12 110649507 nonsense probably null
R4733:Dync1h1 UTSW 12 110649507 nonsense probably null
R4780:Dync1h1 UTSW 12 110661196 missense probably damaging 1.00
R4846:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4861:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4861:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4865:Dync1h1 UTSW 12 110639801 missense possibly damaging 0.84
R4872:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4873:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4874:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4875:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4927:Dync1h1 UTSW 12 110662855 missense possibly damaging 0.82
R4949:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4954:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4956:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4957:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4958:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4984:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4985:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R4988:Dync1h1 UTSW 12 110658126 missense probably damaging 1.00
R5029:Dync1h1 UTSW 12 110618010 missense possibly damaging 0.46
R5032:Dync1h1 UTSW 12 110626892 nonsense probably null
R5036:Dync1h1 UTSW 12 110630535 missense probably damaging 1.00
R5037:Dync1h1 UTSW 12 110640907 missense probably benign 0.09
R5105:Dync1h1 UTSW 12 110617932 missense probably damaging 0.99
R5122:Dync1h1 UTSW 12 110629680 missense probably damaging 1.00
R5156:Dync1h1 UTSW 12 110628830 missense probably benign 0.00
R5290:Dync1h1 UTSW 12 110615068 missense probably benign 0.03
R5453:Dync1h1 UTSW 12 110632665 missense probably benign 0.12
R5540:Dync1h1 UTSW 12 110660950 missense probably benign 0.00
R5613:Dync1h1 UTSW 12 110632820 missense possibly damaging 0.68
R5626:Dync1h1 UTSW 12 110641141 missense probably benign 0.01
R5652:Dync1h1 UTSW 12 110665988 missense possibly damaging 0.70
R5655:Dync1h1 UTSW 12 110629062 missense probably benign 0.03
R5686:Dync1h1 UTSW 12 110616404 missense probably benign 0.35
R5772:Dync1h1 UTSW 12 110646273 nonsense probably null
R5806:Dync1h1 UTSW 12 110651653 missense probably damaging 1.00
R5891:Dync1h1 UTSW 12 110614220 critical splice donor site probably null
R5921:Dync1h1 UTSW 12 110618368 missense probably damaging 1.00
R5965:Dync1h1 UTSW 12 110632778 missense probably benign
R6113:Dync1h1 UTSW 12 110620414 missense probably benign
R6119:Dync1h1 UTSW 12 110628006 missense possibly damaging 0.82
R6154:Dync1h1 UTSW 12 110617993 missense probably damaging 1.00
R6522:Dync1h1 UTSW 12 110616737 missense probably damaging 0.99
R6531:Dync1h1 UTSW 12 110617920 missense probably damaging 1.00
R6554:Dync1h1 UTSW 12 110649848 missense probably benign 0.06
R6672:Dync1h1 UTSW 12 110658134 missense probably damaging 1.00
R6746:Dync1h1 UTSW 12 110651653 missense probably damaging 1.00
R6785:Dync1h1 UTSW 12 110629679 missense probably damaging 1.00
R6857:Dync1h1 UTSW 12 110658547 missense possibly damaging 0.94
R6863:Dync1h1 UTSW 12 110652180 missense probably benign 0.07
R6881:Dync1h1 UTSW 12 110624561 missense probably damaging 1.00
R6892:Dync1h1 UTSW 12 110638901 missense probably benign 0.00
R7015:Dync1h1 UTSW 12 110666087 nonsense probably null
R7096:Dync1h1 UTSW 12 110657078 missense not run
Z1088:Dync1h1 UTSW 12 110629917 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TTTTGTTCCTTAAATCCGTCATATGT -3'
(R):5'- TCTAAGCATGAAGGCAGGAG -3'

Sequencing Primer
(F):5'- GAAGGTCCTGAGTTCAAATCCCTG -3'
(R):5'- TAGGGAAGTGCTTCAAGG -3'
Posted On2018-04-27