Incidental Mutation 'R6339:Dlg5'
ID513843
Institutional Source Beutler Lab
Gene Symbol Dlg5
Ensembl Gene ENSMUSG00000021782
Gene Namediscs large MAGUK scaffold protein 5
Synonyms4933429D20Rik
MMRRC Submission
Accession Numbers

Genbank: NM_001163513; MGI: 1918478

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6339 (G1)
Quality Score199.009
Status Validated
Chromosome14
Chromosomal Location24133953-24245920 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 24158060 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 1003 (H1003L)
Ref Sequence ENSEMBL: ENSMUSP00000073367 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042009] [ENSMUST00000073687] [ENSMUST00000090398]
Predicted Effect probably damaging
Transcript: ENSMUST00000042009
AA Change: H677L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000044852
Gene: ENSMUSG00000021782
AA Change: H677L

DomainStartEndE-ValueType
coiled coil region 20 247 N/A INTRINSIC
low complexity region 261 274 N/A INTRINSIC
PDZ 279 356 2.02e-10 SMART
PDZ 364 447 9.5e-16 SMART
low complexity region 510 517 N/A INTRINSIC
low complexity region 692 711 N/A INTRINSIC
low complexity region 903 918 N/A INTRINSIC
PDZ 1009 1080 2.1e-17 SMART
PDZ 1164 1236 2.97e-8 SMART
SH3 1250 1314 3.73e-7 SMART
low complexity region 1338 1358 N/A INTRINSIC
GuKc 1375 1561 5.43e-53 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000073687
AA Change: H1003L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000073367
Gene: ENSMUSG00000021782
AA Change: H1003L

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 22 36 N/A INTRINSIC
low complexity region 44 66 N/A INTRINSIC
Pfam:Takusan 104 191 1.4e-27 PFAM
coiled coil region 308 578 N/A INTRINSIC
low complexity region 592 605 N/A INTRINSIC
PDZ 610 687 2.02e-10 SMART
PDZ 695 773 1.25e-15 SMART
low complexity region 836 843 N/A INTRINSIC
low complexity region 1018 1037 N/A INTRINSIC
low complexity region 1229 1244 N/A INTRINSIC
PDZ 1335 1406 2.1e-17 SMART
PDZ 1490 1562 2.97e-8 SMART
SH3 1576 1640 3.73e-7 SMART
low complexity region 1664 1684 N/A INTRINSIC
GuKc 1701 1887 5.43e-53 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000090398
AA Change: H1026L

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000087879
Gene: ENSMUSG00000021782
AA Change: H1026L

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 22 36 N/A INTRINSIC
low complexity region 44 66 N/A INTRINSIC
low complexity region 109 123 N/A INTRINSIC
Pfam:Takusan 128 213 6e-33 PFAM
coiled coil region 331 601 N/A INTRINSIC
low complexity region 615 628 N/A INTRINSIC
PDZ 633 710 2.02e-10 SMART
PDZ 718 796 1.25e-15 SMART
low complexity region 859 866 N/A INTRINSIC
low complexity region 1041 1060 N/A INTRINSIC
low complexity region 1252 1267 N/A INTRINSIC
PDZ 1358 1429 2.1e-17 SMART
PDZ 1513 1585 2.97e-8 SMART
SH3 1599 1663 3.73e-7 SMART
low complexity region 1687 1707 N/A INTRINSIC
GuKc 1724 1910 5.43e-53 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167343
Meta Mutation Damage Score 0.164 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.2%
  • 20x: 94.1%
Validation Efficiency 97% (69/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of discs large (DLG) homologs, a subset of the membrane-associated guanylate kinase (MAGUK) superfamily. The MAGUK proteins are composed of a catalytically inactive guanylate kinase domain, in addition to PDZ and SH3 domains, and are thought to function as scaffolding molecules at sites of cell-cell contact. The protein encoded by this gene localizes to the plasma membrane and cytoplasm, and interacts with components of adherens junctions and the cytoskeleton. It is proposed to function in the transmission of extracellular signals to the cytoskeleton and in the maintenance of epithelial cell structure. Alternative splice variants have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit growth retardation, hydroencephaly, abnormal brain morphology, abnormal neurogenesis, kidney cysts, ureter defects, and abnormal kidney morphology. [provided by MGI curators]
Allele List at MGI

All alleles(19) : Targeted, other(1) Gene trapped(18)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,682,505 D1198V probably benign Het
4933424G06Rik A T 1: 36,710,461 probably benign Het
Adgrg6 G T 10: 14,434,347 S743R probably damaging Het
Ak8 A G 2: 28,734,448 probably null Het
Alpk2 A G 18: 65,349,806 M377T probably benign Het
Ap1g1 G A 8: 109,844,368 V425I possibly damaging Het
Apob A T 12: 8,016,188 R4353W probably damaging Het
Arhgef38 T C 3: 133,133,662 K540R probably benign Het
AY761184 G A 8: 21,703,469 S45F possibly damaging Het
B3galt2 A T 1: 143,646,902 T259S possibly damaging Het
Btbd8 G A 5: 107,503,717 V159I probably benign Het
C2cd2l T C 9: 44,313,491 probably benign Het
Carmil3 T C 14: 55,499,849 V763A possibly damaging Het
Ccdc171 A T 4: 83,742,997 T1115S probably damaging Het
Chst2 C T 9: 95,405,750 G181D probably damaging Het
Col7a1 C T 9: 108,956,633 T390M unknown Het
Cpt1a A C 19: 3,362,152 D208A probably benign Het
Crocc2 A G 1: 93,214,032 E1183G probably benign Het
Dok2 A T 14: 70,775,718 I109L probably benign Het
Dpy19l4 A T 4: 11,285,111 I465K probably damaging Het
Dync1h1 A T 12: 110,646,205 D2838V probably damaging Het
Frem3 A G 8: 80,613,015 R646G possibly damaging Het
Gcfc2 T A 6: 81,946,496 F514I probably damaging Het
Gm8104 T C 14: 43,101,485 M44T probably benign Het
Golph3l T A 3: 95,617,439 W334R probably damaging Het
Gpr179 A T 11: 97,344,176 F443I probably damaging Het
Ift172 A G 5: 31,256,583 V1467A probably benign Het
Ift172 A T 5: 31,286,945 D44E probably damaging Het
Il1rl1 C T 1: 40,461,856 A464V possibly damaging Het
Irx5 A G 8: 92,359,853 E188G probably damaging Het
Jak1 A G 4: 101,161,926 V710A probably damaging Het
Kcng4 A T 8: 119,632,954 F228I probably damaging Het
Lifr A G 15: 7,167,049 N238S probably benign Het
Ltbp3 C A 19: 5,747,477 H414Q probably damaging Het
Mcpt8 A G 14: 56,082,337 C219R probably benign Het
Mepce A T 5: 137,785,688 N125K possibly damaging Het
Mfap3 T C 11: 57,529,772 F193S probably damaging Het
Miox T A 15: 89,335,499 Y63* probably null Het
Msl2 A T 9: 101,101,750 H441L probably benign Het
Nemp2 T A 1: 52,640,910 S98T possibly damaging Het
Neto2 G T 8: 85,640,558 A547E probably benign Het
Nol12 T C 15: 78,940,833 probably benign Het
Npr3 T C 15: 11,845,275 I504V probably damaging Het
Olfr1204 A G 2: 88,852,871 D307G probably null Het
Pcdhb3 T C 18: 37,300,945 probably benign Het
Pear1 C A 3: 87,752,520 G720W probably damaging Het
Pibf1 T G 14: 99,107,398 D151E probably damaging Het
Pla2g6 T A 15: 79,308,816 N217I probably damaging Het
Plcd1 G A 9: 119,074,991 R292C probably damaging Het
Plcl1 C T 1: 55,696,315 L272F probably damaging Het
Ppp4r4 A T 12: 103,604,969 K656* probably null Het
Prr22 G A 17: 56,771,490 M214I probably benign Het
Ror1 G T 4: 100,411,931 R322L possibly damaging Het
Sh3tc2 G A 18: 61,975,571 W244* probably null Het
Slamf6 A G 1: 171,948,048 N320S probably null Het
Slc1a6 A C 10: 78,800,085 D328A possibly damaging Het
Sorl1 G T 9: 41,969,742 T2161K probably benign Het
Sstr2 T C 11: 113,624,549 F98S probably damaging Het
Stk33 A T 7: 109,321,465 D348E probably benign Het
Sulf1 T A 1: 12,838,440 L559Q probably damaging Het
Syne2 A G 12: 75,989,153 D3738G probably benign Het
Taok3 A T 5: 117,228,030 Q382L probably benign Het
Tet2 T A 3: 133,486,417 H752L possibly damaging Het
Tia1 A C 6: 86,426,656 K285T probably damaging Het
Tle3 G T 9: 61,401,924 probably null Het
Top1mt T C 15: 75,665,656 T414A possibly damaging Het
Ubc A T 5: 125,387,342 I307N probably damaging Het
Vmn2r96 A T 17: 18,583,862 D266V possibly damaging Het
Wbp2nl G T 15: 82,299,045 W13C possibly damaging Het
Zfp456 T A 13: 67,362,364 K102* probably null Het
Zkscan1 T C 5: 138,093,305 V100A probably damaging Het
Other mutations in Dlg5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Dlg5 APN 14 24191161 missense probably damaging 0.99
IGL00164:Dlg5 APN 14 24158464 missense possibly damaging 0.89
IGL00767:Dlg5 APN 14 24165285 missense probably damaging 1.00
IGL01284:Dlg5 APN 14 24146197 missense probably damaging 1.00
IGL01328:Dlg5 APN 14 24202351 missense probably damaging 0.98
IGL01532:Dlg5 APN 14 24158592 missense probably benign
IGL01621:Dlg5 APN 14 24148221 missense probably damaging 1.00
IGL01649:Dlg5 APN 14 24138691 missense probably damaging 1.00
IGL01733:Dlg5 APN 14 24170449 missense probably damaging 1.00
IGL02048:Dlg5 APN 14 24172203 missense possibly damaging 0.87
IGL02103:Dlg5 APN 14 24144346 missense probably damaging 1.00
IGL02138:Dlg5 APN 14 24158351 missense probably benign
IGL02146:Dlg5 APN 14 24202361 missense probably damaging 0.99
IGL02392:Dlg5 APN 14 24150209 missense probably damaging 1.00
IGL02427:Dlg5 APN 14 24166207 missense probably damaging 1.00
IGL02643:Dlg5 APN 14 24191182 missense probably damaging 1.00
IGL02649:Dlg5 APN 14 24146251 missense probably damaging 0.96
IGL02933:Dlg5 APN 14 24158499 missense probably benign 0.06
IGL02965:Dlg5 APN 14 24172023 missense probably damaging 1.00
IGL02988:Dlg5 APN 14 24166255 missense probably damaging 1.00
IGL03351:Dlg5 APN 14 24170454 missense probably benign 0.03
R0123:Dlg5 UTSW 14 24147206 missense probably benign
R0131:Dlg5 UTSW 14 24138649 missense probably damaging 1.00
R0709:Dlg5 UTSW 14 24146255 missense probably damaging 1.00
R0920:Dlg5 UTSW 14 24176397 missense probably damaging 1.00
R0924:Dlg5 UTSW 14 24135577 missense probably damaging 1.00
R0930:Dlg5 UTSW 14 24135577 missense probably damaging 1.00
R0981:Dlg5 UTSW 14 24154631 missense probably damaging 1.00
R1402:Dlg5 UTSW 14 24176608 missense probably benign 0.06
R1402:Dlg5 UTSW 14 24176608 missense probably benign 0.06
R1438:Dlg5 UTSW 14 24154605 missense possibly damaging 0.94
R1449:Dlg5 UTSW 14 24135643 missense possibly damaging 0.82
R1465:Dlg5 UTSW 14 24154696 splice site probably null
R1465:Dlg5 UTSW 14 24154696 splice site probably null
R1543:Dlg5 UTSW 14 24144448 missense probably damaging 1.00
R1824:Dlg5 UTSW 14 24149444 missense probably benign 0.28
R1899:Dlg5 UTSW 14 24148300 missense probably damaging 1.00
R1920:Dlg5 UTSW 14 24176571 missense probably damaging 1.00
R1921:Dlg5 UTSW 14 24176571 missense probably damaging 1.00
R1951:Dlg5 UTSW 14 24156469 splice site probably benign
R1968:Dlg5 UTSW 14 24164119 nonsense probably null
R2049:Dlg5 UTSW 14 24154647 missense probably damaging 1.00
R2070:Dlg5 UTSW 14 24136635 missense probably damaging 1.00
R2117:Dlg5 UTSW 14 24177758 nonsense probably null
R2139:Dlg5 UTSW 14 24170544 missense probably damaging 1.00
R2153:Dlg5 UTSW 14 24137157 missense probably damaging 1.00
R2283:Dlg5 UTSW 14 24158663 missense probably benign 0.00
R2293:Dlg5 UTSW 14 24158112 missense probably benign
R2356:Dlg5 UTSW 14 24170428 critical splice donor site probably null
R2362:Dlg5 UTSW 14 24158687 missense probably benign 0.04
R2513:Dlg5 UTSW 14 24164525 missense probably damaging 1.00
R3084:Dlg5 UTSW 14 24166190 missense probably damaging 1.00
R3086:Dlg5 UTSW 14 24166190 missense probably damaging 1.00
R3750:Dlg5 UTSW 14 24165260 missense probably damaging 1.00
R3780:Dlg5 UTSW 14 24190310 unclassified probably benign
R3782:Dlg5 UTSW 14 24190310 unclassified probably benign
R3828:Dlg5 UTSW 14 24146158 missense probably damaging 0.99
R4079:Dlg5 UTSW 14 24148260 missense possibly damaging 0.94
R4393:Dlg5 UTSW 14 24177989 critical splice acceptor site probably null
R4615:Dlg5 UTSW 14 24158168 missense probably damaging 1.00
R4664:Dlg5 UTSW 14 24137181 missense possibly damaging 0.90
R4712:Dlg5 UTSW 14 24177983 missense possibly damaging 0.94
R4796:Dlg5 UTSW 14 24144383 missense probably damaging 1.00
R4801:Dlg5 UTSW 14 24154689 missense probably damaging 1.00
R4802:Dlg5 UTSW 14 24154689 missense probably damaging 1.00
R4946:Dlg5 UTSW 14 24154361 missense probably damaging 0.99
R5022:Dlg5 UTSW 14 24136622 missense probably damaging 1.00
R5023:Dlg5 UTSW 14 24136622 missense probably damaging 1.00
R5057:Dlg5 UTSW 14 24136622 missense probably damaging 1.00
R5234:Dlg5 UTSW 14 24192862 missense probably damaging 0.98
R5561:Dlg5 UTSW 14 24177792 missense probably benign 0.03
R5567:Dlg5 UTSW 14 24192913 nonsense probably null
R5570:Dlg5 UTSW 14 24192913 nonsense probably null
R5640:Dlg5 UTSW 14 24170461 missense probably damaging 1.00
R5646:Dlg5 UTSW 14 24158699 missense probably damaging 1.00
R5711:Dlg5 UTSW 14 24150648 missense probably damaging 1.00
R5810:Dlg5 UTSW 14 24146254 missense probably damaging 0.99
R5900:Dlg5 UTSW 14 24149447 missense probably damaging 1.00
R5964:Dlg5 UTSW 14 24164089 missense probably benign
R6190:Dlg5 UTSW 14 24190438 missense probably damaging 0.99
R6240:Dlg5 UTSW 14 24149528 intron probably null
R6276:Dlg5 UTSW 14 24164568 missense probably damaging 1.00
R6508:Dlg5 UTSW 14 24138706 missense probably benign 0.45
R6527:Dlg5 UTSW 14 24190448 missense possibly damaging 0.73
R6593:Dlg5 UTSW 14 24150652 missense probably benign 0.01
R6687:Dlg5 UTSW 14 24190373 missense probably damaging 1.00
R6965:Dlg5 UTSW 14 24149430 missense probably damaging 1.00
R7051:Dlg5 UTSW 14 24146195 missense possibly damaging 0.93
R7075:Dlg5 UTSW 14 24177797 missense possibly damaging 0.49
R7149:Dlg5 UTSW 14 24190424 missense probably benign 0.00
R7182:Dlg5 UTSW 14 24244856 missense
R7203:Dlg5 UTSW 14 24138655 missense probably damaging 1.00
R7216:Dlg5 UTSW 14 24136638 nonsense probably null
R7359:Dlg5 UTSW 14 24164547 missense probably damaging 1.00
YA93:Dlg5 UTSW 14 24155133 unclassified probably benign
Z1088:Dlg5 UTSW 14 24158094 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCGACTTTCTGGGAGGTGAG -3'
(R):5'- AAGGAAGTCCATCTTTGACCC -3'

Sequencing Primer
(F):5'- TGAGGTCTTCATCACAAGGC -3'
(R):5'- TTTGACCCAAATACTTTCAAGCGC -3'
Posted On2018-04-27