Incidental Mutation 'R6340:Mep1a'
ID513901
Institutional Source Beutler Lab
Gene Symbol Mep1a
Ensembl Gene ENSMUSG00000023914
Gene Namemeprin 1 alpha
SynonymsMep-1a, meprin A alpha-subunit, Mep1, meprin alpha, Mep-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6340 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location43474324-43502812 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 43479233 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 395 (N395K)
Ref Sequence ENSEMBL: ENSMUSP00000113838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024707] [ENSMUST00000117137]
PDB Structure
[]
Predicted Effect probably benign
Transcript: ENSMUST00000024707
AA Change: N408K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000024707
Gene: ENSMUSG00000023914
AA Change: N408K

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
ZnMc 83 222 1.16e-41 SMART
MAM 276 445 5.38e-61 SMART
MATH 445 590 6.9e-17 SMART
EGF 687 724 1.35e-2 SMART
transmembrane domain 727 749 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117137
AA Change: N395K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000113838
Gene: ENSMUSG00000023914
AA Change: N395K

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
ZnMc 70 209 1.16e-41 SMART
MAM 263 432 5.38e-61 SMART
MATH 432 577 6.9e-17 SMART
EGF 674 711 1.35e-2 SMART
transmembrane domain 714 736 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 98% (41/42)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased litter size, reduced LPS-induced renal injury and bladder inflammation, and increased susceptibility to sodium dextran sulfate-induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef4 C T 1: 34,732,223 L1204F probably damaging Het
Atp9b T C 18: 80,778,900 D495G probably benign Het
B020011L13Rik G A 1: 117,801,884 V374I probably benign Het
Babam1 T A 8: 71,402,805 V214D probably damaging Het
Chpf2 T C 5: 24,591,775 V573A probably damaging Het
Elmo3 T A 8: 105,306,747 I115N probably damaging Het
Emc1 T A 4: 139,365,563 Y564N probably damaging Het
Fam180a A C 6: 35,315,387 L28R probably damaging Het
Fiz1 C T 7: 5,008,401 A373T possibly damaging Het
Fnip2 A G 3: 79,507,845 F243L probably damaging Het
Gabra5 A T 7: 57,413,748 N309K probably damaging Het
Gm17654 A G 14: 43,578,077 L91P unknown Het
Gm19684 G A 17: 36,127,510 probably null Het
Gm9376 A T 14: 118,267,257 M34L unknown Het
Hmgcr A G 13: 96,665,858 F106S probably damaging Het
Hydin T G 8: 110,354,942 probably null Het
Igf2bp3 A G 6: 49,214,459 Y5H probably damaging Het
Igsf11 A G 16: 39,008,974 T77A probably benign Het
Il20 A G 1: 130,908,381 Y142H probably benign Het
Macf1 A T 4: 123,448,249 D2160E probably benign Het
Melk A G 4: 44,340,633 Y310C probably damaging Het
Mnt A G 11: 74,836,416 K43E probably damaging Het
Nrap A G 19: 56,347,184 I853T probably damaging Het
Ogfrl1 T G 1: 23,369,863 K427N probably benign Het
Olfr341 T C 2: 36,480,020 T37A probably benign Het
Olfr933 T G 9: 38,975,766 L30R probably damaging Het
Pdia4 A G 6: 47,801,018 S347P probably benign Het
Pkd1l1 T G 11: 8,844,649 Q1837H probably benign Het
Pramef6 T C 4: 143,897,307 N99S possibly damaging Het
Pygo1 T A 9: 72,945,429 N299K probably damaging Het
Sirpb1b A T 3: 15,548,665 V52E probably damaging Het
Tdrd7 T A 4: 45,994,517 I305N probably damaging Het
Trav14-1 T C 14: 53,554,498 S102P probably damaging Het
Tsga10 C A 1: 37,835,185 probably benign Het
Uso1 T A 5: 92,199,852 H837Q probably benign Het
Vmn2r82 A T 10: 79,395,893 R575S probably benign Het
Yae1d1 C A 13: 17,993,276 A11S probably benign Het
Zfp277 A G 12: 40,318,549 I459T possibly damaging Het
Other mutations in Mep1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01016:Mep1a APN 17 43479084 missense probably benign 0.00
IGL02814:Mep1a APN 17 43477221 missense probably benign
IGL03000:Mep1a APN 17 43474990 missense probably benign
IGL03335:Mep1a APN 17 43477173 missense possibly damaging 0.63
IGL03410:Mep1a APN 17 43478095 splice site probably null
PIT4544001:Mep1a UTSW 17 43482287 missense probably damaging 1.00
R0127:Mep1a UTSW 17 43497886 splice site probably benign
R0306:Mep1a UTSW 17 43502643 splice site probably benign
R0329:Mep1a UTSW 17 43497898 critical splice donor site probably null
R0330:Mep1a UTSW 17 43497898 critical splice donor site probably null
R0358:Mep1a UTSW 17 43478950 missense possibly damaging 0.92
R0667:Mep1a UTSW 17 43478190 missense probably benign 0.06
R1101:Mep1a UTSW 17 43491693 missense probably benign 0.03
R1458:Mep1a UTSW 17 43491672 missense probably damaging 1.00
R1525:Mep1a UTSW 17 43491636 missense probably damaging 1.00
R1992:Mep1a UTSW 17 43502682 missense probably benign
R2014:Mep1a UTSW 17 43497906 missense probably benign 0.01
R2212:Mep1a UTSW 17 43477263 missense probably benign 0.02
R3946:Mep1a UTSW 17 43475041 nonsense probably null
R4400:Mep1a UTSW 17 43475006 missense possibly damaging 0.77
R4598:Mep1a UTSW 17 43491578 critical splice donor site probably null
R4616:Mep1a UTSW 17 43486241 missense possibly damaging 0.81
R4688:Mep1a UTSW 17 43482248 missense possibly damaging 0.89
R5085:Mep1a UTSW 17 43478144 missense probably damaging 0.99
R5355:Mep1a UTSW 17 43477146 missense probably damaging 0.98
R5832:Mep1a UTSW 17 43478164 missense probably benign 0.27
R5833:Mep1a UTSW 17 43478164 missense probably benign 0.27
R5834:Mep1a UTSW 17 43478164 missense probably benign 0.27
R5835:Mep1a UTSW 17 43478164 missense probably benign 0.27
R6280:Mep1a UTSW 17 43502392 missense probably damaging 1.00
R6340:Mep1a UTSW 17 43479058 missense probably benign 0.00
R6934:Mep1a UTSW 17 43482230 missense probably damaging 0.99
R7247:Mep1a UTSW 17 43475104 missense possibly damaging 0.67
Z1088:Mep1a UTSW 17 43491596 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTGTAGAACCGAGGGCTCAC -3'
(R):5'- ACAGCTGTGGATGCTAACC -3'

Sequencing Primer
(F):5'- ACGAGCTTGTCCCCTTTCACTG -3'
(R):5'- CCTTAAATATCACAAGTGACTGGGC -3'
Posted On2018-04-27