Incidental Mutation 'R6342:Anxa9'
List |< first << previous [record 52 of 958] next >> last >|
ID513911
Institutional Source Beutler Lab
Gene Symbol Anxa9
Ensembl Gene ENSMUSG00000015702
Gene Nameannexin A9
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R6342 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location95296096-95307176 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to C at 95296790 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Tryptophan at position 346 (*346W)
Ref Sequence ENSEMBL: ENSMUSP00000127424 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015846] [ENSMUST00000039537] [ENSMUST00000107183] [ENSMUST00000107187] [ENSMUST00000164406] [ENSMUST00000168223]
Predicted Effect probably null
Transcript: ENSMUST00000015846
AA Change: *346W
SMART Domains Protein: ENSMUSP00000015846
Gene: ENSMUSG00000015702
AA Change: *346W

DomainStartEndE-ValueType
ANX 58 110 1.48e-17 SMART
ANX 130 182 6.56e-10 SMART
ANX 212 264 1.52e-1 SMART
ANX 287 339 1.03e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000039537
SMART Domains Protein: ENSMUSP00000043910
Gene: ENSMUSG00000038712

DomainStartEndE-ValueType
low complexity region 35 54 N/A INTRINSIC
low complexity region 67 86 N/A INTRINSIC
Pfam:DUF544 143 268 7.7e-51 PFAM
low complexity region 369 382 N/A INTRINSIC
low complexity region 386 397 N/A INTRINSIC
low complexity region 405 423 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107183
AA Change: *346W
SMART Domains Protein: ENSMUSP00000102801
Gene: ENSMUSG00000015702
AA Change: *346W

DomainStartEndE-ValueType
ANX 58 110 1.48e-17 SMART
ANX 130 182 6.56e-10 SMART
ANX 212 264 1.52e-1 SMART
ANX 287 339 1.03e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107187
SMART Domains Protein: ENSMUSP00000102805
Gene: ENSMUSG00000038712

DomainStartEndE-ValueType
low complexity region 35 54 N/A INTRINSIC
low complexity region 67 86 N/A INTRINSIC
Pfam:DUF544 143 266 7e-42 PFAM
low complexity region 369 382 N/A INTRINSIC
low complexity region 400 406 N/A INTRINSIC
low complexity region 414 432 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133762
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135264
Predicted Effect probably null
Transcript: ENSMUST00000164406
AA Change: *346W
SMART Domains Protein: ENSMUSP00000127424
Gene: ENSMUSG00000015702
AA Change: *346W

DomainStartEndE-ValueType
ANX 58 110 1.48e-17 SMART
ANX 130 182 6.56e-10 SMART
ANX 212 264 1.52e-1 SMART
ANX 287 339 1.03e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168223
SMART Domains Protein: ENSMUSP00000127839
Gene: ENSMUSG00000038712

DomainStartEndE-ValueType
low complexity region 35 54 N/A INTRINSIC
low complexity region 67 86 N/A INTRINSIC
Pfam:DUF544 143 268 7.7e-51 PFAM
low complexity region 369 382 N/A INTRINSIC
low complexity region 386 397 N/A INTRINSIC
low complexity region 405 423 N/A INTRINSIC
Meta Mutation Damage Score 0.484 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency 97% (31/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The annexins are a family of calcium-dependent phospholipid-binding proteins. Members of the annexin family contain 4 internal repeat domains, each of which includes a type II calcium-binding site. The calcium-binding sites are required for annexins to aggregate and cooperatively bind anionic phospholipids and extracellular matrix proteins. This gene encodes a divergent member of the annexin protein family in which all four homologous type II calcium-binding sites in the conserved tetrad core contain amino acid substitutions that ablate their function. However, structural analysis suggests that the conserved putative ion channel formed by the tetrad core is intact. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap4b1 T C 3: 103,813,368 V118A possibly damaging Het
Atrnl1 T C 19: 57,638,510 S183P probably damaging Het
Cadm3 T C 1: 173,341,108 T298A possibly damaging Het
Crtc1 A C 8: 70,439,557 M1R probably null Het
Dalrd3 A T 9: 108,571,123 K291* probably null Het
Dhrs9 C T 2: 69,393,187 T93M probably benign Het
Dnmt1 G T 9: 20,909,793 S1267* probably null Het
Dsg1b T C 18: 20,390,243 I109T probably damaging Het
Epha3 C A 16: 63,583,500 R745L probably damaging Het
Evi2 A G 11: 79,515,958 S264P probably benign Het
Grin2a A T 16: 9,579,334 L963Q probably damaging Het
Klhdc7a T A 4: 139,967,059 R192S probably benign Het
Kynu G T 2: 43,681,451 D460Y probably benign Het
Lrfn2 G A 17: 49,097,000 G717D probably benign Het
Lrp3 C T 7: 35,202,306 D696N probably benign Het
Ogfrl1 T G 1: 23,369,863 K427N probably benign Het
Olfr586 T C 7: 103,122,356 T143A probably damaging Het
Rad17 A T 13: 100,619,136 I579N probably damaging Het
Rif1 T A 2: 52,119,156 Y2316N probably damaging Het
Ros1 T A 10: 52,155,255 D430V probably damaging Het
Rp9 A T 9: 22,449,858 H44Q probably damaging Het
Rtl1 T C 12: 109,592,301 T1035A possibly damaging Het
Slc2a5 A C 4: 150,139,526 D225A possibly damaging Het
Tlx3 A T 11: 33,202,567 V176E possibly damaging Het
Trpv3 G A 11: 73,283,863 G352D probably damaging Het
Ubr4 C A 4: 139,429,539 H2292N possibly damaging Het
Wee2 A G 6: 40,444,255 H93R probably benign Het
Xirp2 T G 2: 67,511,650 L1412V possibly damaging Het
Zfat T C 15: 68,180,982 H321R probably damaging Het
Zfp623 C A 15: 75,947,988 C264* probably null Het
Zfp687 G C 3: 95,011,877 P195A probably benign Het
Other mutations in Anxa9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01567:Anxa9 APN 3 95302432 splice site probably benign
IGL01618:Anxa9 APN 3 95300536 unclassified probably null
IGL02272:Anxa9 APN 3 95305894 missense probably benign 0.11
R0012:Anxa9 UTSW 3 95308095 unclassified probably benign
R0128:Anxa9 UTSW 3 95302422 missense probably benign 0.02
R0130:Anxa9 UTSW 3 95302422 missense probably benign 0.02
R0356:Anxa9 UTSW 3 95308076 unclassified probably benign
R1656:Anxa9 UTSW 3 95300573 missense probably benign 0.02
R1967:Anxa9 UTSW 3 95300608 missense probably benign 0.00
R2180:Anxa9 UTSW 3 95306424 critical splice acceptor site probably null
R2359:Anxa9 UTSW 3 95302751 missense probably damaging 1.00
R3155:Anxa9 UTSW 3 95302405 missense probably benign 0.04
R3156:Anxa9 UTSW 3 95302405 missense probably benign 0.04
R3767:Anxa9 UTSW 3 95301114 missense probably benign 0.00
R4693:Anxa9 UTSW 3 95297356 missense probably benign 0.00
R4974:Anxa9 UTSW 3 95308013 unclassified probably benign
R5435:Anxa9 UTSW 3 95297250 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCTAGAATGGAGCTGGAAGATG -3'
(R):5'- CCTTCCATTGAGTGTGGGAC -3'

Sequencing Primer
(F):5'- TGCCAGTCTGAGAAGAGGGAAATC -3'
(R):5'- TGTGGGACTCCAGGCATGAG -3'
Posted On2018-04-27