Mutagenetix > Incidental Mutation

Incidental Mutation 'R6342:Dalrd3'

513922

Institutional Source

Beutler Lab

Gene Symbol

Dalrd3

Ensembl Gene

ENSMUSG00000019039

Gene Name

DALR anticodon binding domain containing 3

Synonyms

6330580J24Rik

MMRRC Submission

044496-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6342 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

108447085-108449973 bp(+) (GRCm39)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 108448322 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 291 (K291*)

Ref Sequence

ENSEMBL: ENSMUSP00000019183 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000019183] [ENSMUST00000068700] [ENSMUST00000074208] [ENSMUST00000195249] [ENSMUST00000193427] [ENSMUST00000194381]

AlphaFold

Q6PJN8

Predicted Effect

probably null
Transcript: ENSMUST00000019183
AA Change: K291*

SMART Domains

Protein: ENSMUSP00000019183
Gene: ENSMUSG00000019039
AA Change: K291*

Domain	Start	End	E-Value	Type
low complexity region	288	301	N/A	INTRINSIC
low complexity region	386	397	N/A	INTRINSIC
DALR_1	399	538	2.09e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000068700

SMART Domains

Protein: ENSMUSP00000070927
Gene: ENSMUSG00000066357

Domain	Start	End	E-Value	Type
Blast:WD40	109	142	3e-6	BLAST
WD40	198	237	1.42e-4	SMART
WD40	247	284	7.28e-2	SMART
WD40	286	326	1.72e-3	SMART
Blast:WD40	336	375	3e-13	BLAST
WD40	479	519	2.96e1	SMART
low complexity region	537	552	N/A	INTRINSIC
WD40	559	598	1.77e2	SMART
Blast:WD40	600	641	7e-20	BLAST
Blast:WD40	764	815	2e-22	BLAST
Blast:WD40	855	896	2e-11	BLAST
WD40	900	949	1.48e1	SMART
WD40	973	1015	5.52e-2	SMART
WD40	1035	1076	3.98e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000074208

SMART Domains

Protein: ENSMUSP00000073832
Gene: ENSMUSG00000070283

Domain	Start	End	E-Value	Type
Pfam:DUF498	61	169	9.3e-37	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000083645

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000175174

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191881

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191897

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193846

Predicted Effect

probably benign
Transcript: ENSMUST00000195249

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196210

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192651

Predicted Effect

probably benign
Transcript: ENSMUST00000193427

SMART Domains

Protein: ENSMUSP00000141748
Gene: ENSMUSG00000019039

Domain	Start	End	E-Value	Type
low complexity region	55	66	N/A	INTRINSIC
DALR_1	68	171	1.3e-7	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193044

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194666

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194104

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193242

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193193

Predicted Effect

probably benign
Transcript: ENSMUST00000194381

Predicted Effect

probably benign
Transcript: ENSMUST00000192518

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.1%

Validation Efficiency

97% (31/32)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The exact function of this gene is not known. It encodes a protein with a DALR anticodon binding domain similar to that of class Ia aminoacyl tRNA synthetases. This gene is located in a cluster of genes (with a complex sense-anti-sense genome architecture) on chromosome 3, and contains two micro RNA (miRNA) precursors (mir-425 and mir-191) in one of its introns. Preferential expression of this gene (the miRNAs and other genes in the cluster) in testis suggests a role of this gene in spermatogenesis (PMID:19906709). [provided by RefSeq, Feb 2013]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Anxa9	T	C	3: 95,204,101 (GRCm39)	*346W	probably null	Het
Ap4b1	T	C	3: 103,720,684 (GRCm39)	V118A	possibly damaging	Het
Atrnl1	T	C	19: 57,626,942 (GRCm39)	S183P	probably damaging	Het
Cadm3	T	C	1: 173,168,675 (GRCm39)	T298A	possibly damaging	Het
Crtc1	A	C	8: 70,892,207 (GRCm39)	M1R	probably null	Het
Dhrs9	C	T	2: 69,223,531 (GRCm39)	T93M	probably benign	Het
Dnmt1	G	T	9: 20,821,089 (GRCm39)	S1267*	probably null	Het
Dsg1b	T	C	18: 20,523,300 (GRCm39)	I109T	probably damaging	Het
Epha3	C	A	16: 63,403,863 (GRCm39)	R745L	probably damaging	Het
Evi2	A	G	11: 79,406,784 (GRCm39)	S264P	probably benign	Het
Grin2a	A	T	16: 9,397,198 (GRCm39)	L963Q	probably damaging	Het
Klhdc7a	T	A	4: 139,694,370 (GRCm39)	R192S	probably benign	Het
Kynu	G	T	2: 43,571,463 (GRCm39)	D460Y	probably benign	Het
Lrfn2	G	A	17: 49,404,028 (GRCm39)	G717D	probably benign	Het
Lrp3	C	T	7: 34,901,731 (GRCm39)	D696N	probably benign	Het
Ogfrl1	T	G	1: 23,408,944 (GRCm39)	K427N	probably benign	Het
Or51a5	T	C	7: 102,771,563 (GRCm39)	T143A	probably damaging	Het
Rad17	A	T	13: 100,755,644 (GRCm39)	I579N	probably damaging	Het
Rif1	T	A	2: 52,009,168 (GRCm39)	Y2316N	probably damaging	Het
Ros1	T	A	10: 52,031,351 (GRCm39)	D430V	probably damaging	Het
Rp9	A	T	9: 22,361,154 (GRCm39)	H44Q	probably damaging	Het
Rtl1	T	C	12: 109,558,735 (GRCm39)	T1035A	possibly damaging	Het
Slc2a5	A	C	4: 150,223,983 (GRCm39)	D225A	possibly damaging	Het
Tlx3	A	T	11: 33,152,567 (GRCm39)	V176E	possibly damaging	Het
Trpv3	G	A	11: 73,174,689 (GRCm39)	G352D	probably damaging	Het
Ubr4	C	A	4: 139,156,850 (GRCm39)	H2292N	possibly damaging	Het
Wee2	A	G	6: 40,421,189 (GRCm39)	H93R	probably benign	Het
Xirp2	T	G	2: 67,341,994 (GRCm39)	L1412V	possibly damaging	Het
Zfat	T	C	15: 68,052,831 (GRCm39)	H321R	probably damaging	Het
Zfp623	C	A	15: 75,819,837 (GRCm39)	C264*	probably null	Het
Zfp687	G	C	3: 94,919,188 (GRCm39)	P195A	probably benign	Het

Other mutations in Dalrd3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02441:Dalrd3	APN	9	108,448,725 (GRCm39)	unclassified	probably benign
IGL02699:Dalrd3	APN	9	108,448,088 (GRCm39)	splice site	probably benign
IGL02701:Dalrd3	APN	9	108,449,483 (GRCm39)	missense	possibly damaging	0.95
R0051:Dalrd3	UTSW	9	108,449,414 (GRCm39)	missense	possibly damaging	0.89
R0051:Dalrd3	UTSW	9	108,449,414 (GRCm39)	missense	possibly damaging	0.89
R2025:Dalrd3	UTSW	9	108,448,284 (GRCm39)	missense	probably benign	0.08
R4425:Dalrd3	UTSW	9	108,448,800 (GRCm39)	unclassified	probably benign
R4552:Dalrd3	UTSW	9	108,449,429 (GRCm39)	missense	possibly damaging	0.67
R4660:Dalrd3	UTSW	9	108,447,568 (GRCm39)	missense	probably benign
R4876:Dalrd3	UTSW	9	108,448,635 (GRCm39)	splice site	probably benign
R5642:Dalrd3	UTSW	9	108,449,489 (GRCm39)	missense	probably damaging	1.00
R5854:Dalrd3	UTSW	9	108,447,276 (GRCm39)	critical splice donor site	probably null
R9004:Dalrd3	UTSW	9	108,449,430 (GRCm39)	missense	probably benign	0.00
R9381:Dalrd3	UTSW	9	108,448,242 (GRCm39)	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- CTGAAGATGTGCTCTCTGTGC -3'
(R):5'- ACTACATAGTCACAGGACATTTGC -3'

Sequencing Primer
(F):5'- AAGATGTGCTCTCTGTGCTCTCG -3'
(R):5'- CAGGACATTTGCACTTGTAGCACG -3'

Posted On

2018-04-27