Incidental Mutation 'R6346:Apbb1ip'
ID513940
Institutional Source Beutler Lab
Gene Symbol Apbb1ip
Ensembl Gene ENSMUSG00000026786
Gene Nameamyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein
Synonyms9930118P07Rik, Prp48, proline-rich protein 48
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6346 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location22774094-22875653 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to G at 22866993 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000014290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014290]
PDB Structure
Crystal structure of the Ras-associating and pleckstrin-homology domains of RIAM [X-RAY DIFFRACTION]
Crystal structure of RIAM RA-PH domains in complex with GTP bound Rap1 [X-RAY DIFFRACTION]
Crystal structure of RIAM TBS1 in complex with talin R7R8 domains [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000014290
SMART Domains Protein: ENSMUSP00000014290
Gene: ENSMUSG00000026786

DomainStartEndE-ValueType
PDB:3ZDL|B 1 31 1e-11 PDB
low complexity region 32 39 N/A INTRINSIC
coiled coil region 62 88 N/A INTRINSIC
low complexity region 102 118 N/A INTRINSIC
RA 179 266 1.15e-22 SMART
low complexity region 280 299 N/A INTRINSIC
PH 314 424 2.05e-10 SMART
low complexity region 516 532 N/A INTRINSIC
low complexity region 553 570 N/A INTRINSIC
low complexity region 577 598 N/A INTRINSIC
low complexity region 622 636 N/A INTRINSIC
Meta Mutation Damage Score 0.576 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 98% (41/42)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and healthy with no apparent defects in platelet integrin activation and function, hemostasis, or arterial thrombus formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 C T 7: 75,685,254 S455L probably damaging Het
Arhgap18 A T 10: 26,846,065 I11F probably damaging Het
Arl14epl A T 18: 46,926,342 N8I possibly damaging Het
Atp4a T A 7: 30,715,356 I190N possibly damaging Het
Bfar T C 16: 13,702,133 F285S probably damaging Het
Carf C T 1: 60,141,540 Q409* probably null Het
Cd244 T C 1: 171,577,321 V247A probably damaging Het
Ceacam12 T A 7: 18,069,401 I244K probably damaging Het
Cmya5 T C 13: 93,092,190 E2130G probably damaging Het
Cyp2b23 T G 7: 26,681,725 H69P probably damaging Het
Dixdc1 T C 9: 50,683,953 Q183R probably damaging Het
Dock10 T A 1: 80,575,856 probably null Het
Fam20c T C 5: 138,766,695 F279S probably damaging Het
Hcn4 C T 9: 58,859,044 T665I unknown Het
Helz2 C T 2: 181,233,467 E1745K probably damaging Het
Kdm7a A T 6: 39,151,211 probably null Het
Ksr1 A C 11: 79,019,664 L814R possibly damaging Het
Lmnb1 A G 18: 56,743,238 I473V probably benign Het
Mllt3 T C 4: 87,841,208 K201R probably damaging Het
Myo1b C T 1: 51,784,507 C413Y probably damaging Het
Myom3 A T 4: 135,806,051 N1185I probably benign Het
Nrde2 A G 12: 100,132,306 S701P probably benign Het
Ntn4 A T 10: 93,644,861 D112V probably damaging Het
Nup43 T A 10: 7,675,062 V232D probably damaging Het
Pcdha6 G A 18: 36,968,060 C102Y probably damaging Het
Pcdhgb8 T C 18: 37,762,078 L67P probably damaging Het
Pkd1l3 A G 8: 109,631,384 H836R probably damaging Het
Plekha1 T A 7: 130,877,782 I10N probably benign Het
Prss29 A G 17: 25,321,110 T161A possibly damaging Het
Psmb5 C A 14: 54,616,673 R116L probably damaging Het
Rsf1 A AGGGCGACGG 7: 97,579,904 probably null Het
Secisbp2 C T 13: 51,679,887 H688Y probably damaging Het
Senp5 A G 16: 31,983,847 Y508H probably damaging Het
Shc3 T A 13: 51,451,615 T210S possibly damaging Het
Slc27a2 G A 2: 126,587,880 V467M probably damaging Het
Slc27a5 T A 7: 12,990,972 E487V possibly damaging Het
Snx1 T C 9: 66,094,648 T298A possibly damaging Het
Trir A G 8: 85,027,014 D39G possibly damaging Het
Ubd C T 17: 37,195,351 Q43* probably null Het
Ube2o T C 11: 116,541,368 E924G probably damaging Het
Vps13a T C 19: 16,682,214 I1650V possibly damaging Het
Xirp2 C A 2: 67,516,081 R2889S probably benign Het
Zfp804b T C 5: 6,770,534 E843G probably benign Het
Other mutations in Apbb1ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Apbb1ip APN 2 22858280 missense possibly damaging 0.59
IGL01447:Apbb1ip APN 2 22853182 missense probably damaging 1.00
IGL02987:Apbb1ip APN 2 22867637 nonsense probably null
IGL03329:Apbb1ip APN 2 22867717 missense possibly damaging 0.92
psyops UTSW 2 22853120 nonsense probably null
Simulacrum UTSW 2 22866993 critical splice donor site probably null
R0374:Apbb1ip UTSW 2 22819705 splice site probably benign
R0842:Apbb1ip UTSW 2 22867666 missense possibly damaging 0.85
R1678:Apbb1ip UTSW 2 22874880 synonymous probably null
R3855:Apbb1ip UTSW 2 22875175 missense unknown
R3971:Apbb1ip UTSW 2 22823494 missense unknown
R4335:Apbb1ip UTSW 2 22871562 critical splice donor site probably null
R4569:Apbb1ip UTSW 2 22849544 missense probably damaging 1.00
R4742:Apbb1ip UTSW 2 22826916 missense unknown
R4804:Apbb1ip UTSW 2 22823598 critical splice donor site probably null
R4820:Apbb1ip UTSW 2 22875253 missense unknown
R4854:Apbb1ip UTSW 2 22853202 missense possibly damaging 0.94
R4899:Apbb1ip UTSW 2 22823349 missense unknown
R4920:Apbb1ip UTSW 2 22819684 missense unknown
R5283:Apbb1ip UTSW 2 22867671 missense probably benign 0.16
R5445:Apbb1ip UTSW 2 22835948 missense possibly damaging 0.90
R6495:Apbb1ip UTSW 2 22853120 nonsense probably null
R6542:Apbb1ip UTSW 2 22874960 missense probably benign 0.04
R6550:Apbb1ip UTSW 2 22858233 missense probably damaging 1.00
R7011:Apbb1ip UTSW 2 22835931 missense probably damaging 1.00
X0014:Apbb1ip UTSW 2 22823554 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- AAACTGCCTTTGCCACCATC -3'
(R):5'- TTCTCTTGCCAGAGGACAGGTG -3'

Sequencing Primer
(F):5'- GCCTTTGCCACCATCTCAGTAAATC -3'
(R):5'- CCAGAGGACAGGTGTGTGC -3'
Posted On2018-04-27