Incidental Mutation 'R6346:Fam20c'
ID513947
Institutional Source Beutler Lab
Gene Symbol Fam20c
Ensembl Gene ENSMUSG00000025854
Gene Namefamily with sequence similarity 20, member C
SynonymsDMP4
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.437) question?
Stock #R6346 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location138754514-138810077 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 138766695 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 279 (F279S)
Ref Sequence ENSEMBL: ENSMUSP00000026972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026972] [ENSMUST00000160645]
Predicted Effect probably damaging
Transcript: ENSMUST00000026972
AA Change: F279S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000026972
Gene: ENSMUSG00000025854
AA Change: F279S

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
low complexity region 49 63 N/A INTRINSIC
low complexity region 132 156 N/A INTRINSIC
Pfam:Fam20C 349 565 4.5e-108 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160645
SMART Domains Protein: ENSMUSP00000124584
Gene: ENSMUSG00000025854

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
low complexity region 49 63 N/A INTRINSIC
low complexity region 132 156 N/A INTRINSIC
Meta Mutation Damage Score 0.512 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of secreted protein kinases. The encoded protein binds calcium and phosphorylates proteins involved in bone mineralization. Mutations in this gene are associated with the autosomal recessive disorder Raine syndrome. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice with global conditional deletion of this gene display infertility, dwarfism, delayed bone ossification, reduced bone mineralization, fragile skeletons, hypophosphatemic rickets, and impaired osteoblast differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 C T 7: 75,685,254 S455L probably damaging Het
Apbb1ip T G 2: 22,866,993 probably null Het
Arhgap18 A T 10: 26,846,065 I11F probably damaging Het
Arl14epl A T 18: 46,926,342 N8I possibly damaging Het
Atp4a T A 7: 30,715,356 I190N possibly damaging Het
Bfar T C 16: 13,702,133 F285S probably damaging Het
Carf C T 1: 60,141,540 Q409* probably null Het
Cd244 T C 1: 171,577,321 V247A probably damaging Het
Ceacam12 T A 7: 18,069,401 I244K probably damaging Het
Cmya5 T C 13: 93,092,190 E2130G probably damaging Het
Cyp2b23 T G 7: 26,681,725 H69P probably damaging Het
Dixdc1 T C 9: 50,683,953 Q183R probably damaging Het
Dock10 T A 1: 80,575,856 probably null Het
Hcn4 C T 9: 58,859,044 T665I unknown Het
Helz2 C T 2: 181,233,467 E1745K probably damaging Het
Kdm7a A T 6: 39,151,211 probably null Het
Ksr1 A C 11: 79,019,664 L814R possibly damaging Het
Lmnb1 A G 18: 56,743,238 I473V probably benign Het
Mllt3 T C 4: 87,841,208 K201R probably damaging Het
Myo1b C T 1: 51,784,507 C413Y probably damaging Het
Myom3 A T 4: 135,806,051 N1185I probably benign Het
Nrde2 A G 12: 100,132,306 S701P probably benign Het
Ntn4 A T 10: 93,644,861 D112V probably damaging Het
Nup43 T A 10: 7,675,062 V232D probably damaging Het
Pcdha6 G A 18: 36,968,060 C102Y probably damaging Het
Pcdhgb8 T C 18: 37,762,078 L67P probably damaging Het
Pkd1l3 A G 8: 109,631,384 H836R probably damaging Het
Plekha1 T A 7: 130,877,782 I10N probably benign Het
Prss29 A G 17: 25,321,110 T161A possibly damaging Het
Psmb5 C A 14: 54,616,673 R116L probably damaging Het
Rsf1 A AGGGCGACGG 7: 97,579,904 probably null Het
Secisbp2 C T 13: 51,679,887 H688Y probably damaging Het
Senp5 A G 16: 31,983,847 Y508H probably damaging Het
Shc3 T A 13: 51,451,615 T210S possibly damaging Het
Slc27a2 G A 2: 126,587,880 V467M probably damaging Het
Slc27a5 T A 7: 12,990,972 E487V possibly damaging Het
Snx1 T C 9: 66,094,648 T298A possibly damaging Het
Trir A G 8: 85,027,014 D39G possibly damaging Het
Ubd C T 17: 37,195,351 Q43* probably null Het
Ube2o T C 11: 116,541,368 E924G probably damaging Het
Vps13a T C 19: 16,682,214 I1650V possibly damaging Het
Xirp2 C A 2: 67,516,081 R2889S probably benign Het
Zfp804b T C 5: 6,770,534 E843G probably benign Het
Other mutations in Fam20c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00975:Fam20c APN 5 138809157 missense probably benign
IGL01096:Fam20c APN 5 138809155 missense possibly damaging 0.93
IGL01393:Fam20c APN 5 138807271 missense probably damaging 1.00
IGL01576:Fam20c APN 5 138807339 missense probably damaging 0.98
IGL01960:Fam20c APN 5 138806320 missense probably damaging 0.99
IGL02317:Fam20c APN 5 138806360 missense probably damaging 1.00
IGL02979:Fam20c APN 5 138757865 missense probably damaging 1.00
IGL02988:Fam20c UTSW 5 138755994 missense probably benign 0.20
R0197:Fam20c UTSW 5 138755724 missense probably damaging 1.00
R0594:Fam20c UTSW 5 138766637 missense possibly damaging 0.94
R0615:Fam20c UTSW 5 138807486 missense probably damaging 0.99
R1672:Fam20c UTSW 5 138807301 missense probably damaging 1.00
R2044:Fam20c UTSW 5 138756227 critical splice donor site probably null
R2484:Fam20c UTSW 5 138809117 missense probably benign
R3418:Fam20c UTSW 5 138757868 missense probably damaging 0.99
R3419:Fam20c UTSW 5 138757868 missense probably damaging 0.99
R4205:Fam20c UTSW 5 138755676 missense probably damaging 1.00
R5966:Fam20c UTSW 5 138756177 missense probably damaging 1.00
R7290:Fam20c UTSW 5 138807554 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGAAGACCTAGCTGACTGGC -3'
(R):5'- TCTCCCTCACAGAACAAGATGG -3'

Sequencing Primer
(F):5'- CAGCTAGAGCCTTGATCCAG -3'
(R):5'- GAACCATCTCCAGGTATGTAATGGTG -3'
Posted On2018-04-27