Incidental Mutation 'R6346:Ksr1'
ID513964
Institutional Source Beutler Lab
Gene Symbol Ksr1
Ensembl Gene ENSMUSG00000018334
Gene Namekinase suppressor of ras 1
SynonymsD11Bhm183e, B-KSR1, D11Bhm184e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.204) question?
Stock #R6346 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location79013440-79146407 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 79019664 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 814 (L814R)
Ref Sequence ENSEMBL: ENSMUSP00000018478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018478] [ENSMUST00000226282]
PDB Structure
Solution structure of the cysteine-rich C1 domain of Kinase Suppressor of Ras [SOLUTION NMR]
Solution Structure of the Cysteine-Rich C1 Domain of Kinase Suppressor of Ras [SOLUTION NMR]
Solution NMR Structure of the KSR1 CA1-CA1a domain [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000018478
AA Change: L814R

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000018478
Gene: ENSMUSG00000018334
AA Change: L814R

DomainStartEndE-ValueType
low complexity region 8 31 N/A INTRINSIC
Pfam:KSR1-SAM 39 166 2.7e-41 PFAM
low complexity region 271 278 N/A INTRINSIC
C1 334 377 5.48e-8 SMART
low complexity region 429 464 N/A INTRINSIC
low complexity region 519 530 N/A INTRINSIC
Pfam:Pkinase_Tyr 563 827 2.3e-48 PFAM
Pfam:Pkinase 563 828 1.5e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143473
Predicted Effect unknown
Transcript: ENSMUST00000209031
AA Change: L29R
Predicted Effect possibly damaging
Transcript: ENSMUST00000226282
AA Change: L732R

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 98% (41/42)
MGI Phenotype PHENOTYPE: Homozygous mutant mice exhibit disorganized hair follicles and a decreased susceptibility to papilloma formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 C T 7: 75,685,254 S455L probably damaging Het
Apbb1ip T G 2: 22,866,993 probably null Het
Arhgap18 A T 10: 26,846,065 I11F probably damaging Het
Arl14epl A T 18: 46,926,342 N8I possibly damaging Het
Atp4a T A 7: 30,715,356 I190N possibly damaging Het
Bfar T C 16: 13,702,133 F285S probably damaging Het
Carf C T 1: 60,141,540 Q409* probably null Het
Cd244 T C 1: 171,577,321 V247A probably damaging Het
Ceacam12 T A 7: 18,069,401 I244K probably damaging Het
Cmya5 T C 13: 93,092,190 E2130G probably damaging Het
Cyp2b23 T G 7: 26,681,725 H69P probably damaging Het
Dixdc1 T C 9: 50,683,953 Q183R probably damaging Het
Dock10 T A 1: 80,575,856 probably null Het
Fam20c T C 5: 138,766,695 F279S probably damaging Het
Hcn4 C T 9: 58,859,044 T665I unknown Het
Helz2 C T 2: 181,233,467 E1745K probably damaging Het
Kdm7a A T 6: 39,151,211 probably null Het
Lmnb1 A G 18: 56,743,238 I473V probably benign Het
Mllt3 T C 4: 87,841,208 K201R probably damaging Het
Myo1b C T 1: 51,784,507 C413Y probably damaging Het
Myom3 A T 4: 135,806,051 N1185I probably benign Het
Nrde2 A G 12: 100,132,306 S701P probably benign Het
Ntn4 A T 10: 93,644,861 D112V probably damaging Het
Nup43 T A 10: 7,675,062 V232D probably damaging Het
Pcdha6 G A 18: 36,968,060 C102Y probably damaging Het
Pcdhgb8 T C 18: 37,762,078 L67P probably damaging Het
Pkd1l3 A G 8: 109,631,384 H836R probably damaging Het
Plekha1 T A 7: 130,877,782 I10N probably benign Het
Prss29 A G 17: 25,321,110 T161A possibly damaging Het
Psmb5 C A 14: 54,616,673 R116L probably damaging Het
Rsf1 A AGGGCGACGG 7: 97,579,904 probably null Het
Secisbp2 C T 13: 51,679,887 H688Y probably damaging Het
Senp5 A G 16: 31,983,847 Y508H probably damaging Het
Shc3 T A 13: 51,451,615 T210S possibly damaging Het
Slc27a2 G A 2: 126,587,880 V467M probably damaging Het
Slc27a5 T A 7: 12,990,972 E487V possibly damaging Het
Snx1 T C 9: 66,094,648 T298A possibly damaging Het
Trir A G 8: 85,027,014 D39G possibly damaging Het
Ubd C T 17: 37,195,351 Q43* probably null Het
Ube2o T C 11: 116,541,368 E924G probably damaging Het
Vps13a T C 19: 16,682,214 I1650V possibly damaging Het
Xirp2 C A 2: 67,516,081 R2889S probably benign Het
Zfp804b T C 5: 6,770,534 E843G probably benign Het
Other mutations in Ksr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Ksr1 APN 11 79027517 missense probably damaging 1.00
IGL01304:Ksr1 APN 11 79027642 missense probably damaging 1.00
IGL01482:Ksr1 APN 11 79036583 missense probably damaging 1.00
IGL01928:Ksr1 APN 11 79044839 splice site probably null
IGL02025:Ksr1 APN 11 79021450 unclassified probably null
IGL02176:Ksr1 APN 11 79020791 missense probably benign 0.00
IGL02374:Ksr1 APN 11 79028491 missense probably benign 0.02
IGL02511:Ksr1 APN 11 79045220 missense possibly damaging 0.55
IGL02563:Ksr1 APN 11 79044858 missense possibly damaging 0.73
IGL02662:Ksr1 APN 11 79036725 missense probably damaging 1.00
IGL02823:Ksr1 APN 11 79021403 missense probably benign 0.35
IGL02879:Ksr1 APN 11 79074444 missense probably damaging 1.00
julius UTSW 11 79036494 critical splice donor site probably null
R0096:Ksr1 UTSW 11 79038247 splice site probably benign
R0096:Ksr1 UTSW 11 79038247 splice site probably benign
R0364:Ksr1 UTSW 11 79029025 splice site probably benign
R0479:Ksr1 UTSW 11 79025283 missense probably damaging 1.00
R0590:Ksr1 UTSW 11 79045140 missense probably damaging 1.00
R0711:Ksr1 UTSW 11 79038247 splice site probably benign
R0743:Ksr1 UTSW 11 79021503 missense possibly damaging 0.79
R0884:Ksr1 UTSW 11 79021503 missense possibly damaging 0.79
R1272:Ksr1 UTSW 11 79146078 nonsense probably null
R1739:Ksr1 UTSW 11 79047305 missense probably damaging 1.00
R1885:Ksr1 UTSW 11 79020378 missense probably null
R1885:Ksr1 UTSW 11 79036521 missense probably damaging 1.00
R1886:Ksr1 UTSW 11 79020378 missense probably null
R2118:Ksr1 UTSW 11 79045193 missense probably benign 0.10
R2127:Ksr1 UTSW 11 79033313 missense probably damaging 1.00
R2939:Ksr1 UTSW 11 79045181 unclassified probably null
R4090:Ksr1 UTSW 11 79027477 missense probably damaging 1.00
R4675:Ksr1 UTSW 11 79074360 missense possibly damaging 0.81
R4854:Ksr1 UTSW 11 79027702 missense probably damaging 1.00
R5267:Ksr1 UTSW 11 79020425 missense probably damaging 1.00
R5813:Ksr1 UTSW 11 79038198 missense probably damaging 1.00
R5928:Ksr1 UTSW 11 79059719 missense probably damaging 0.96
R6199:Ksr1 UTSW 11 79020441 missense possibly damaging 0.65
R6377:Ksr1 UTSW 11 79036494 critical splice donor site probably null
R6885:Ksr1 UTSW 11 79047295 critical splice donor site probably null
R7016:Ksr1 UTSW 11 79027536 missense probably damaging 1.00
U24488:Ksr1 UTSW 11 79047441 missense probably damaging 1.00
Z1088:Ksr1 UTSW 11 79044879 unclassified probably null
Predicted Primers PCR Primer
(F):5'- GAATCCTTCAGCTCCTACACCG -3'
(R):5'- CTGGAAGGTTGGAGGATCAC -3'

Sequencing Primer
(F):5'- TTCAGCTCCTACACCGTGGAAG -3'
(R):5'- GGATCACCTGATTCTGACTCCACAG -3'
Posted On2018-04-27