Incidental Mutation 'R6346:Psmb5'
ID513970
Institutional Source Beutler Lab
Gene Symbol Psmb5
Ensembl Gene ENSMUSG00000022193
Gene Nameproteasome (prosome, macropain) subunit, beta type 5
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R6346 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location54614119-54618022 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 54616673 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 116 (R116L)
Ref Sequence ENSEMBL: ENSMUSP00000022803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022803] [ENSMUST00000227257] [ENSMUST00000228446]
PDB Structure
Mouse constitutive 20S proteasome in complex with PR-957 [X-RAY DIFFRACTION]
Mouse constitutive 20S proteasome [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000022803
AA Change: R116L

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022803
Gene: ENSMUSG00000022193
AA Change: R116L

DomainStartEndE-ValueType
low complexity region 17 42 N/A INTRINSIC
Pfam:Proteasome 56 238 8.3e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102174
Predicted Effect probably benign
Transcript: ENSMUST00000227257
Predicted Effect probably benign
Transcript: ENSMUST00000228446
Meta Mutation Damage Score 0.546 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the proteasome B-type family, also known as the T1B family, that is a 20S core beta subunit in the proteasome. This catalytic subunit is not present in the immunoproteasome and is replaced by catalytic subunit 3i (proteasome beta 8 subunit). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2009]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 C T 7: 75,685,254 S455L probably damaging Het
Apbb1ip T G 2: 22,866,993 probably null Het
Arhgap18 A T 10: 26,846,065 I11F probably damaging Het
Arl14epl A T 18: 46,926,342 N8I possibly damaging Het
Atp4a T A 7: 30,715,356 I190N possibly damaging Het
Bfar T C 16: 13,702,133 F285S probably damaging Het
Carf C T 1: 60,141,540 Q409* probably null Het
Cd244 T C 1: 171,577,321 V247A probably damaging Het
Ceacam12 T A 7: 18,069,401 I244K probably damaging Het
Cmya5 T C 13: 93,092,190 E2130G probably damaging Het
Cyp2b23 T G 7: 26,681,725 H69P probably damaging Het
Dixdc1 T C 9: 50,683,953 Q183R probably damaging Het
Dock10 T A 1: 80,575,856 probably null Het
Fam20c T C 5: 138,766,695 F279S probably damaging Het
Hcn4 C T 9: 58,859,044 T665I unknown Het
Helz2 C T 2: 181,233,467 E1745K probably damaging Het
Kdm7a A T 6: 39,151,211 probably null Het
Ksr1 A C 11: 79,019,664 L814R possibly damaging Het
Lmnb1 A G 18: 56,743,238 I473V probably benign Het
Mllt3 T C 4: 87,841,208 K201R probably damaging Het
Myo1b C T 1: 51,784,507 C413Y probably damaging Het
Myom3 A T 4: 135,806,051 N1185I probably benign Het
Nrde2 A G 12: 100,132,306 S701P probably benign Het
Ntn4 A T 10: 93,644,861 D112V probably damaging Het
Nup43 T A 10: 7,675,062 V232D probably damaging Het
Pcdha6 G A 18: 36,968,060 C102Y probably damaging Het
Pcdhgb8 T C 18: 37,762,078 L67P probably damaging Het
Pkd1l3 A G 8: 109,631,384 H836R probably damaging Het
Plekha1 T A 7: 130,877,782 I10N probably benign Het
Prss29 A G 17: 25,321,110 T161A possibly damaging Het
Rsf1 A AGGGCGACGG 7: 97,579,904 probably null Het
Secisbp2 C T 13: 51,679,887 H688Y probably damaging Het
Senp5 A G 16: 31,983,847 Y508H probably damaging Het
Shc3 T A 13: 51,451,615 T210S possibly damaging Het
Slc27a2 G A 2: 126,587,880 V467M probably damaging Het
Slc27a5 T A 7: 12,990,972 E487V possibly damaging Het
Snx1 T C 9: 66,094,648 T298A possibly damaging Het
Trir A G 8: 85,027,014 D39G possibly damaging Het
Ubd C T 17: 37,195,351 Q43* probably null Het
Ube2o T C 11: 116,541,368 E924G probably damaging Het
Vps13a T C 19: 16,682,214 I1650V possibly damaging Het
Xirp2 C A 2: 67,516,081 R2889S probably benign Het
Zfp804b T C 5: 6,770,534 E843G probably benign Het
Other mutations in Psmb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Psmb5 APN 14 54617807 missense possibly damaging 0.85
IGL02967:Psmb5 APN 14 54616626 missense probably benign 0.11
IGL03095:Psmb5 APN 14 54616557 missense probably damaging 1.00
R2447:Psmb5 UTSW 14 54614470 missense probably damaging 0.97
R5651:Psmb5 UTSW 14 54616764 missense possibly damaging 0.64
R6372:Psmb5 UTSW 14 54616673 missense probably damaging 0.98
R6657:Psmb5 UTSW 14 54614383 missense possibly damaging 0.61
R6687:Psmb5 UTSW 14 54616673 missense probably damaging 0.98
R6688:Psmb5 UTSW 14 54616673 missense probably damaging 0.98
R6752:Psmb5 UTSW 14 54616755 missense probably benign 0.00
R7007:Psmb5 UTSW 14 54616709 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGCTCACAGGACACAACTC -3'
(R):5'- ATGCAAAGCCAGGTTATCTTTCTG -3'

Sequencing Primer
(F):5'- ACTCACCAGGGCCTCTC -3'
(R):5'- TGGTCTTACGGGGCCTCTC -3'
Posted On2018-04-27