Incidental Mutation 'R6343:Chrm5'
ID513984
Institutional Source Beutler Lab
Gene Symbol Chrm5
Ensembl Gene ENSMUSG00000074939
Gene Namecholinergic receptor, muscarinic 5
SynonymsM5R, muscarinic acetylcholine receptor 5
MMRRC Submission
Accession Numbers

Genbank: NM_205783; MGI: 109248

Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock #R6343 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location112479171-112480769 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 112479448 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 441 (A441V)
Ref Sequence ENSEMBL: ENSMUSP00000097185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099589]
Predicted Effect probably damaging
Transcript: ENSMUST00000099589
AA Change: A441V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000097185
Gene: ENSMUSG00000074939
AA Change: A441V

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 38 242 2.3e-8 PFAM
Pfam:7TM_GPCR_Srsx 41 253 7.5e-8 PFAM
Pfam:7tm_1 47 495 1.5e-79 PFAM
low complexity region 507 518 N/A INTRINSIC
Meta Mutation Damage Score 0.124 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The muscarinic cholinergic receptors belong to a larger family of G protein-coupled receptors. The functional diversity of these receptors is defined by the binding of acetylcholine and includes cellular responses such as adenylate cyclase inhibition, phosphoinositide degeneration, and potassium channel mediation. Muscarinic receptors influence many effects of acetylcholine in the central and peripheral nervous system. The clinical implications of this receptor are unknown; however, stimulation of this receptor is known to increase cyclic AMP levels. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null allele exhibit loss of acetylcholine-induced dilation of cerebral arteries, decreased pilocarpine-induced salivation, increased water-deprivation induced drinking, and attenuated morphine reinforcement and withdrawal. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(3)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A T 11: 110,314,552 L301Q probably damaging Het
Adgrl4 T C 3: 151,517,806 L632P probably damaging Het
Cacna2d1 T A 5: 16,322,564 I539N probably benign Het
Camta1 T A 4: 151,079,849 H314L probably damaging Het
Car2 T C 3: 14,887,965 S56P probably damaging Het
Ckap5 T A 2: 91,596,474 N1380K possibly damaging Het
Cspg4 T C 9: 56,892,692 V1580A probably benign Het
Dcc A G 18: 71,336,035 L1099P probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Epha5 A T 5: 84,106,747 H644Q probably damaging Het
Eya3 T C 4: 132,672,910 I80T probably damaging Het
Fdft1 A T 14: 63,151,272 Y304N probably damaging Het
Fiz1 C T 7: 5,008,401 A373T possibly damaging Het
Gpatch2l T A 12: 86,260,605 Y252* probably null Het
Hivep1 G T 13: 42,159,671 G1796* probably null Het
Irf8 T C 8: 120,753,707 V228A probably damaging Het
Islr A C 9: 58,157,096 V376G probably damaging Het
Kdm5a T C 6: 120,382,933 V230A probably benign Het
Lpgat1 A G 1: 191,776,572 probably null Het
Lrp8 T C 4: 107,869,156 probably null Het
Lyzl4 A C 9: 121,578,084 S127A possibly damaging Het
Map4k1 T C 7: 29,000,290 V606A possibly damaging Het
Mau2 T A 8: 70,031,523 K138N probably damaging Het
Meikin T C 11: 54,370,766 L33P probably damaging Het
Mrpl28 T C 17: 26,126,278 V224A probably benign Het
Ncdn T C 4: 126,747,171 D512G possibly damaging Het
Nlrp2 T A 7: 5,300,926 Q200L possibly damaging Het
Nup98 T C 7: 102,194,750 N89S possibly damaging Het
Ogfrl1 T G 1: 23,369,863 K427N probably benign Het
Olfr1448 G T 19: 12,919,582 H242Q probably damaging Het
Olfr304 T A 7: 86,385,851 R270* probably null Het
Olfr551 A G 7: 102,588,546 C66R probably damaging Het
Olfr770 A T 10: 129,133,666 L34* probably null Het
Padi3 C T 4: 140,803,508 V68I possibly damaging Het
Pign A T 1: 105,585,095 M621K probably benign Het
Pigv C T 4: 133,665,236 V208M probably damaging Het
Ripk4 A G 16: 97,763,526 probably null Het
Rsf1 A G 7: 97,660,917 K285E probably benign Het
Serpina3k G C 12: 104,345,303 G380A probably benign Het
Sorbs1 A G 19: 40,376,982 probably null Het
Srrd G C 5: 112,340,000 A104G probably benign Het
Tbp T A 17: 15,501,089 probably null Het
Tecrl G A 5: 83,294,600 H209Y probably damaging Het
Tmprss11c A G 5: 86,256,345 L157P probably damaging Het
Tmprss13 A T 9: 45,343,200 T422S possibly damaging Het
Ttll5 A G 12: 85,956,699 H1103R probably benign Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Vldlr A G 19: 27,245,649 Y699C probably damaging Het
Vmn1r22 T G 6: 57,900,578 N138T possibly damaging Het
Other mutations in Chrm5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01532:Chrm5 APN 2 112479232 missense probably benign
IGL01611:Chrm5 APN 2 112480306 nonsense probably null
IGL02152:Chrm5 APN 2 112480568 missense probably damaging 1.00
IGL03002:Chrm5 APN 2 112480361 missense probably damaging 1.00
C9142:Chrm5 UTSW 2 112480211 missense probably damaging 1.00
R0200:Chrm5 UTSW 2 112480720 missense probably benign
R0432:Chrm5 UTSW 2 112479655 missense possibly damaging 0.76
R1158:Chrm5 UTSW 2 112479869 missense probably benign 0.00
R1611:Chrm5 UTSW 2 112479187 missense possibly damaging 0.74
R1621:Chrm5 UTSW 2 112479837 missense probably benign 0.00
R1693:Chrm5 UTSW 2 112479280 missense probably damaging 1.00
R1988:Chrm5 UTSW 2 112480252 missense probably damaging 0.99
R1989:Chrm5 UTSW 2 112480252 missense probably damaging 0.99
R2071:Chrm5 UTSW 2 112479227 missense probably null 0.93
R2890:Chrm5 UTSW 2 112479703 missense probably benign 0.00
R4659:Chrm5 UTSW 2 112479757 missense probably benign
R4785:Chrm5 UTSW 2 112479585 missense probably benign 0.25
R5196:Chrm5 UTSW 2 112480384 missense probably damaging 1.00
R5734:Chrm5 UTSW 2 112480100 missense probably benign 0.28
R6499:Chrm5 UTSW 2 112480480 missense probably benign
R6672:Chrm5 UTSW 2 112479796 missense probably benign
R6905:Chrm5 UTSW 2 112479556 missense probably benign 0.00
X0023:Chrm5 UTSW 2 112480481 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCAGCAGCTTAAAGGTCTTCC -3'
(R):5'- AGTGTGTTGCCTATAAGTTCCG -3'

Sequencing Primer
(F):5'- CAGCAGCTTAAAGGTCTTCCTGAAG -3'
(R):5'- TCCGATTGGTGGTAAAAGCTGAC -3'
Posted On2018-04-27