Incidental Mutation 'R6343:Map4k1'
ID514002
Institutional Source Beutler Lab
Gene Symbol Map4k1
Ensembl Gene ENSMUSG00000037337
Gene Namemitogen-activated protein kinase kinase kinase kinase 1
SynonymsHpk1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6343 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location28982050-29003279 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 29000290 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 606 (V606A)
Ref Sequence ENSEMBL: ENSMUSP00000146807 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032813] [ENSMUST00000085835] [ENSMUST00000179893] [ENSMUST00000207185] [ENSMUST00000208227] [ENSMUST00000214374]
Predicted Effect probably benign
Transcript: ENSMUST00000032813
SMART Domains Protein: ENSMUSP00000032813
Gene: ENSMUSG00000030592

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
MIR 99 154 7.52e-4 SMART
MIR 161 206 1.11e-6 SMART
MIR 212 266 1.23e-8 SMART
MIR 272 362 1.05e-25 SMART
Pfam:RYDR_ITPR 441 645 1.2e-73 PFAM
SPRY 660 798 2.79e-27 SMART
Pfam:RyR 851 945 6.5e-33 PFAM
Pfam:RyR 965 1059 1.5e-30 PFAM
SPRY 1086 1209 8.62e-42 SMART
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1340 1349 N/A INTRINSIC
SPRY 1431 1571 3.05e-33 SMART
low complexity region 1787 1798 N/A INTRINSIC
coiled coil region 1871 1932 N/A INTRINSIC
low complexity region 1989 1998 N/A INTRINSIC
low complexity region 2048 2057 N/A INTRINSIC
low complexity region 2069 2092 N/A INTRINSIC
Pfam:RYDR_ITPR 2158 2366 7e-66 PFAM
low complexity region 2390 2404 N/A INTRINSIC
Pfam:RyR 2735 2829 9.7e-34 PFAM
Pfam:RyR 2855 2943 5.7e-32 PFAM
low complexity region 3130 3144 N/A INTRINSIC
low complexity region 3290 3304 N/A INTRINSIC
low complexity region 3375 3394 N/A INTRINSIC
PDB:2BCX|B 3613 3642 2e-13 PDB
low complexity region 3681 3691 N/A INTRINSIC
low complexity region 3735 3760 N/A INTRINSIC
Pfam:RIH_assoc 3872 4004 1.9e-41 PFAM
low complexity region 4010 4023 N/A INTRINSIC
Pfam:EF-hand_8 4085 4136 9.8e-8 PFAM
transmembrane domain 4283 4305 N/A INTRINSIC
transmembrane domain 4318 4336 N/A INTRINSIC
transmembrane domain 4341 4363 N/A INTRINSIC
Pfam:RR_TM4-6 4377 4666 2e-86 PFAM
Pfam:Ion_trans 4761 4932 3.4e-10 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000085835
AA Change: V652A

PolyPhen 2 Score 0.644 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000082995
Gene: ENSMUSG00000037337
AA Change: V652A

DomainStartEndE-ValueType
S_TKc 17 274 3.58e-84 SMART
low complexity region 301 318 N/A INTRINSIC
low complexity region 373 383 N/A INTRINSIC
low complexity region 385 416 N/A INTRINSIC
low complexity region 426 446 N/A INTRINSIC
CNH 506 813 4.93e-106 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179893
SMART Domains Protein: ENSMUSP00000137123
Gene: ENSMUSG00000030592

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
MIR 99 154 7.52e-4 SMART
MIR 161 206 1.11e-6 SMART
MIR 212 266 1.23e-8 SMART
MIR 272 362 1.05e-25 SMART
Pfam:RYDR_ITPR 443 638 4.5e-63 PFAM
SPRY 660 798 2.79e-27 SMART
Pfam:RyR 852 942 1.3e-37 PFAM
Pfam:RyR 966 1056 1.6e-28 PFAM
SPRY 1086 1209 8.62e-42 SMART
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1340 1349 N/A INTRINSIC
SPRY 1431 1571 3.05e-33 SMART
low complexity region 1787 1798 N/A INTRINSIC
coiled coil region 1871 1932 N/A INTRINSIC
low complexity region 1989 1998 N/A INTRINSIC
low complexity region 2048 2057 N/A INTRINSIC
low complexity region 2069 2092 N/A INTRINSIC
Pfam:RYDR_ITPR 2160 2366 2.2e-68 PFAM
low complexity region 2390 2404 N/A INTRINSIC
Pfam:RyR 2736 2826 7.2e-31 PFAM
Pfam:RyR 2856 2940 5.6e-27 PFAM
low complexity region 3130 3144 N/A INTRINSIC
low complexity region 3290 3304 N/A INTRINSIC
low complexity region 3375 3394 N/A INTRINSIC
PDB:2BCX|B 3615 3644 2e-13 PDB
low complexity region 3683 3693 N/A INTRINSIC
low complexity region 3737 3762 N/A INTRINSIC
Pfam:RIH_assoc 3878 3996 6.2e-35 PFAM
low complexity region 4012 4025 N/A INTRINSIC
Pfam:EF-hand_8 4087 4137 1.8e-8 PFAM
transmembrane domain 4285 4307 N/A INTRINSIC
transmembrane domain 4320 4338 N/A INTRINSIC
transmembrane domain 4343 4365 N/A INTRINSIC
Pfam:RR_TM4-6 4379 4668 8.4e-76 PFAM
Pfam:Ion_trans 4763 4946 2.8e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207185
Predicted Effect possibly damaging
Transcript: ENSMUST00000208227
AA Change: V606A

PolyPhen 2 Score 0.763 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208784
Predicted Effect probably benign
Transcript: ENSMUST00000214374
Meta Mutation Damage Score 0.152 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (51/51)
MGI Phenotype PHENOTYPE: Homozygous null mice have increased responses of B and T cells. Dendritic cells are also hyperresponsive to stimulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A T 11: 110,314,552 L301Q probably damaging Het
Adgrl4 T C 3: 151,517,806 L632P probably damaging Het
Cacna2d1 T A 5: 16,322,564 I539N probably benign Het
Camta1 T A 4: 151,079,849 H314L probably damaging Het
Car2 T C 3: 14,887,965 S56P probably damaging Het
Chrm5 G A 2: 112,479,448 A441V probably damaging Het
Ckap5 T A 2: 91,596,474 N1380K possibly damaging Het
Cspg4 T C 9: 56,892,692 V1580A probably benign Het
Dcc A G 18: 71,336,035 L1099P probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Epha5 A T 5: 84,106,747 H644Q probably damaging Het
Eya3 T C 4: 132,672,910 I80T probably damaging Het
Fdft1 A T 14: 63,151,272 Y304N probably damaging Het
Fiz1 C T 7: 5,008,401 A373T possibly damaging Het
Gpatch2l T A 12: 86,260,605 Y252* probably null Het
Hivep1 G T 13: 42,159,671 G1796* probably null Het
Irf8 T C 8: 120,753,707 V228A probably damaging Het
Islr A C 9: 58,157,096 V376G probably damaging Het
Kdm5a T C 6: 120,382,933 V230A probably benign Het
Lpgat1 A G 1: 191,776,572 probably null Het
Lrp8 T C 4: 107,869,156 probably null Het
Lyzl4 A C 9: 121,578,084 S127A possibly damaging Het
Mau2 T A 8: 70,031,523 K138N probably damaging Het
Meikin T C 11: 54,370,766 L33P probably damaging Het
Mrpl28 T C 17: 26,126,278 V224A probably benign Het
Ncdn T C 4: 126,747,171 D512G possibly damaging Het
Nlrp2 T A 7: 5,300,926 Q200L possibly damaging Het
Nup98 T C 7: 102,194,750 N89S possibly damaging Het
Ogfrl1 T G 1: 23,369,863 K427N probably benign Het
Olfr1448 G T 19: 12,919,582 H242Q probably damaging Het
Olfr304 T A 7: 86,385,851 R270* probably null Het
Olfr551 A G 7: 102,588,546 C66R probably damaging Het
Olfr770 A T 10: 129,133,666 L34* probably null Het
Padi3 C T 4: 140,803,508 V68I possibly damaging Het
Pign A T 1: 105,585,095 M621K probably benign Het
Pigv C T 4: 133,665,236 V208M probably damaging Het
Ripk4 A G 16: 97,763,526 probably null Het
Rsf1 A G 7: 97,660,917 K285E probably benign Het
Serpina3k G C 12: 104,345,303 G380A probably benign Het
Sorbs1 A G 19: 40,376,982 probably null Het
Srrd G C 5: 112,340,000 A104G probably benign Het
Tbp T A 17: 15,501,089 probably null Het
Tecrl G A 5: 83,294,600 H209Y probably damaging Het
Tmprss11c A G 5: 86,256,345 L157P probably damaging Het
Tmprss13 A T 9: 45,343,200 T422S possibly damaging Het
Ttll5 A G 12: 85,956,699 H1103R probably benign Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Vldlr A G 19: 27,245,649 Y699C probably damaging Het
Vmn1r22 T G 6: 57,900,578 N138T possibly damaging Het
Other mutations in Map4k1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01538:Map4k1 APN 7 29001619 missense probably damaging 0.98
IGL01936:Map4k1 APN 7 28988607 missense possibly damaging 0.90
IGL02473:Map4k1 APN 7 28999872 missense probably damaging 1.00
IGL02934:Map4k1 APN 7 28994106 missense probably benign 0.00
IGL03180:Map4k1 APN 7 28988085 missense probably damaging 1.00
IGL03199:Map4k1 APN 7 28983417 missense probably damaging 1.00
IGL03493:Map4k1 APN 7 28984151 unclassified probably benign
R0333:Map4k1 UTSW 7 28999761 unclassified probably benign
R1296:Map4k1 UTSW 7 28998452 missense possibly damaging 0.96
R1305:Map4k1 UTSW 7 28995465 missense probably benign
R1519:Map4k1 UTSW 7 28991036 missense probably benign 0.00
R1711:Map4k1 UTSW 7 28989352 missense possibly damaging 0.80
R1842:Map4k1 UTSW 7 28987163 missense probably damaging 1.00
R1851:Map4k1 UTSW 7 28999784 missense probably benign
R2042:Map4k1 UTSW 7 28984130 missense probably damaging 1.00
R2274:Map4k1 UTSW 7 29001957 missense probably damaging 1.00
R2275:Map4k1 UTSW 7 29001957 missense probably damaging 1.00
R4426:Map4k1 UTSW 7 28988595 missense probably damaging 1.00
R4568:Map4k1 UTSW 7 28986654 missense probably damaging 1.00
R4858:Map4k1 UTSW 7 28988770 missense probably damaging 1.00
R4903:Map4k1 UTSW 7 28983002 missense probably benign 0.01
R4964:Map4k1 UTSW 7 28983002 missense probably benign 0.01
R4966:Map4k1 UTSW 7 28983002 missense probably benign 0.01
R5124:Map4k1 UTSW 7 28988832 missense probably damaging 1.00
R5778:Map4k1 UTSW 7 28994221 missense probably benign 0.37
R5786:Map4k1 UTSW 7 29000020 missense probably damaging 1.00
R6475:Map4k1 UTSW 7 28987022 missense probably damaging 1.00
R6702:Map4k1 UTSW 7 29002396 missense possibly damaging 0.86
R6703:Map4k1 UTSW 7 29002396 missense possibly damaging 0.86
R6856:Map4k1 UTSW 7 28986834 missense probably damaging 1.00
R6870:Map4k1 UTSW 7 29001671 critical splice donor site probably null
R6904:Map4k1 UTSW 7 28986802 missense probably damaging 1.00
R7081:Map4k1 UTSW 7 28991149 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGACCCTTGGAGAGATACTGG -3'
(R):5'- TGAGGGACGGGGCTTAAATATC -3'

Sequencing Primer
(F):5'- CTTGGAGAGATACTGGGGGATCC -3'
(R):5'- AAATGCCTCAGGATGGGA -3'
Posted On2018-04-27