Incidental Mutation 'R6343:Islr'
ID514012
Institutional Source Beutler Lab
Gene Symbol Islr
Ensembl Gene ENSMUSG00000037206
Gene Nameimmunoglobulin superfamily containing leucine-rich repeat
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R6343 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location58156268-58204306 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 58157096 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 376 (V376G)
Ref Sequence ENSEMBL: ENSMUSP00000126963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034880] [ENSMUST00000041477] [ENSMUST00000085677] [ENSMUST00000167479] [ENSMUST00000168864] [ENSMUST00000170397] [ENSMUST00000217578]
Predicted Effect probably benign
Transcript: ENSMUST00000034880
SMART Domains Protein: ENSMUSP00000034880
Gene: ENSMUSG00000032327

DomainStartEndE-ValueType
Pfam:RBP_receptor 40 659 1.6e-253 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000041477
AA Change: V376G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000045142
Gene: ENSMUSG00000037206
AA Change: V376G

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
LRRNT 18 54 3.32e-1 SMART
LRR 50 72 1.49e1 SMART
LRR 73 96 5.26e0 SMART
LRR 97 120 1.86e1 SMART
LRR_TYP 121 144 5.81e-2 SMART
LRR_TYP 145 168 5.21e-4 SMART
LRRCT 180 230 2.42e-9 SMART
IGc2 248 334 9.78e-7 SMART
low complexity region 408 426 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085677
SMART Domains Protein: ENSMUSP00000082820
Gene: ENSMUSG00000032327

DomainStartEndE-ValueType
Pfam:RBP_receptor 41 658 1.9e-248 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167479
SMART Domains Protein: ENSMUSP00000128417
Gene: ENSMUSG00000032327

DomainStartEndE-ValueType
Pfam:RBP_receptor 40 659 1.6e-253 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168864
AA Change: V376G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126963
Gene: ENSMUSG00000037206
AA Change: V376G

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
LRRNT 18 54 3.32e-1 SMART
LRR 50 72 1.49e1 SMART
LRR 73 96 5.26e0 SMART
LRR 97 120 1.86e1 SMART
LRR_TYP 121 144 5.81e-2 SMART
LRR_TYP 145 168 5.21e-4 SMART
LRRCT 180 230 2.42e-9 SMART
IGc2 248 334 9.78e-7 SMART
low complexity region 408 426 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170397
SMART Domains Protein: ENSMUSP00000130232
Gene: ENSMUSG00000032327

DomainStartEndE-ValueType
Pfam:RBP_receptor 40 659 1.6e-253 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217578
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (51/51)
MGI Phenotype PHENOTYPE: The gene product suppresses differentiation of bone marrow stromal and skeletal stem cells into skeletal lineages. Homozygous knockout leads to growth retardation and longer long bones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A T 11: 110,314,552 L301Q probably damaging Het
Adgrl4 T C 3: 151,517,806 L632P probably damaging Het
Cacna2d1 T A 5: 16,322,564 I539N probably benign Het
Camta1 T A 4: 151,079,849 H314L probably damaging Het
Car2 T C 3: 14,887,965 S56P probably damaging Het
Chrm5 G A 2: 112,479,448 A441V probably damaging Het
Ckap5 T A 2: 91,596,474 N1380K possibly damaging Het
Cspg4 T C 9: 56,892,692 V1580A probably benign Het
Dcc A G 18: 71,336,035 L1099P probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Epha5 A T 5: 84,106,747 H644Q probably damaging Het
Eya3 T C 4: 132,672,910 I80T probably damaging Het
Fdft1 A T 14: 63,151,272 Y304N probably damaging Het
Fiz1 C T 7: 5,008,401 A373T possibly damaging Het
Gpatch2l T A 12: 86,260,605 Y252* probably null Het
Hivep1 G T 13: 42,159,671 G1796* probably null Het
Irf8 T C 8: 120,753,707 V228A probably damaging Het
Kdm5a T C 6: 120,382,933 V230A probably benign Het
Lpgat1 A G 1: 191,776,572 probably null Het
Lrp8 T C 4: 107,869,156 probably null Het
Lyzl4 A C 9: 121,578,084 S127A possibly damaging Het
Map4k1 T C 7: 29,000,290 V606A possibly damaging Het
Mau2 T A 8: 70,031,523 K138N probably damaging Het
Meikin T C 11: 54,370,766 L33P probably damaging Het
Mrpl28 T C 17: 26,126,278 V224A probably benign Het
Ncdn T C 4: 126,747,171 D512G possibly damaging Het
Nlrp2 T A 7: 5,300,926 Q200L possibly damaging Het
Nup98 T C 7: 102,194,750 N89S possibly damaging Het
Ogfrl1 T G 1: 23,369,863 K427N probably benign Het
Olfr1448 G T 19: 12,919,582 H242Q probably damaging Het
Olfr304 T A 7: 86,385,851 R270* probably null Het
Olfr551 A G 7: 102,588,546 C66R probably damaging Het
Olfr770 A T 10: 129,133,666 L34* probably null Het
Padi3 C T 4: 140,803,508 V68I possibly damaging Het
Pign A T 1: 105,585,095 M621K probably benign Het
Pigv C T 4: 133,665,236 V208M probably damaging Het
Ripk4 A G 16: 97,763,526 probably null Het
Rsf1 A G 7: 97,660,917 K285E probably benign Het
Serpina3k G C 12: 104,345,303 G380A probably benign Het
Sorbs1 A G 19: 40,376,982 probably null Het
Srrd G C 5: 112,340,000 A104G probably benign Het
Tbp T A 17: 15,501,089 probably null Het
Tecrl G A 5: 83,294,600 H209Y probably damaging Het
Tmprss11c A G 5: 86,256,345 L157P probably damaging Het
Tmprss13 A T 9: 45,343,200 T422S possibly damaging Het
Ttll5 A G 12: 85,956,699 H1103R probably benign Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Vldlr A G 19: 27,245,649 Y699C probably damaging Het
Vmn1r22 T G 6: 57,900,578 N138T possibly damaging Het
Other mutations in Islr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01012:Islr APN 9 58157228 missense probably damaging 1.00
IGL02169:Islr APN 9 58158132 missense possibly damaging 0.92
IGL02369:Islr APN 9 58157624 missense probably damaging 1.00
IGL02930:Islr APN 9 58158200 unclassified probably benign
PIT4581001:Islr UTSW 9 58157201 missense possibly damaging 0.92
R1121:Islr UTSW 9 58157762 missense probably benign 0.21
R1470:Islr UTSW 9 58157306 missense probably damaging 1.00
R1470:Islr UTSW 9 58157306 missense probably damaging 1.00
R1638:Islr UTSW 9 58158219 unclassified probably benign
R1699:Islr UTSW 9 58157495 missense probably damaging 1.00
R4360:Islr UTSW 9 58157604 missense probably damaging 1.00
R4677:Islr UTSW 9 58157359 missense probably damaging 1.00
R4707:Islr UTSW 9 58157687 missense possibly damaging 0.75
R4856:Islr UTSW 9 58157606 missense probably damaging 0.99
R5354:Islr UTSW 9 58157612 missense probably damaging 1.00
R6768:Islr UTSW 9 58157610 missense possibly damaging 0.75
R7050:Islr UTSW 9 58157717 missense probably damaging 1.00
R7216:Islr UTSW 9 58156967 missense unknown
Predicted Primers PCR Primer
(F):5'- CATTGGCAGGAACGTGATCAG -3'
(R):5'- ACTTTGGCAAGCTGGAGGAG -3'

Sequencing Primer
(F):5'- TGCTCTAGCCAACCAGGG -3'
(R):5'- CAAGCTGGAGGAGGGCAC -3'
Posted On2018-04-27