Incidental Mutation 'R6343:Dnase1l1'
ID514028
Institutional Source Beutler Lab
Gene Symbol Dnase1l1
Ensembl Gene ENSMUSG00000019088
Gene Namedeoxyribonuclease 1-like 1
SynonymsDnase1ll, G4.8, Dnl1ll, 2310005K03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R6343 (G1)
Quality Score221.999
Status Validated
ChromosomeX
Chromosomal Location74273217-74282337 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 74277038 bp
ZygosityHomozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008826] [ENSMUST00000019232] [ENSMUST00000074085] [ENSMUST00000075821] [ENSMUST00000114189] [ENSMUST00000119361] [ENSMUST00000135690] [ENSMUST00000151702]
Predicted Effect probably benign
Transcript: ENSMUST00000008826
SMART Domains Protein: ENSMUSP00000008826
Gene: ENSMUSG00000008682

DomainStartEndE-ValueType
Pfam:Ribosomal_L16 5 167 1.1e-34 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000019232
SMART Domains Protein: ENSMUSP00000019232
Gene: ENSMUSG00000019088

DomainStartEndE-ValueType
DNaseIc 21 289 3.93e-149 SMART
low complexity region 301 313 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000074085
SMART Domains Protein: ENSMUSP00000082055
Gene: ENSMUSG00000008682

DomainStartEndE-ValueType
Pfam:Ribosomal_L16 5 167 1.1e-34 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000075821
SMART Domains Protein: ENSMUSP00000075218
Gene: ENSMUSG00000019088

DomainStartEndE-ValueType
DNaseIc 21 289 3.93e-149 SMART
low complexity region 301 313 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083047
Predicted Effect probably null
Transcript: ENSMUST00000114189
SMART Domains Protein: ENSMUSP00000109827
Gene: ENSMUSG00000019088

DomainStartEndE-ValueType
Blast:DNaseIc 21 70 5e-22 BLAST
SCOP:d2dnja_ 39 79 2e-4 SMART
low complexity region 91 103 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000119361
SMART Domains Protein: ENSMUSP00000113515
Gene: ENSMUSG00000019088

DomainStartEndE-ValueType
Blast:DNaseIc 21 64 2e-22 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121868
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125775
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128763
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134330
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135012
Predicted Effect probably benign
Transcript: ENSMUST00000135690
SMART Domains Protein: ENSMUSP00000119500
Gene: ENSMUSG00000008682

DomainStartEndE-ValueType
Pfam:Ribosomal_L16 5 150 1.2e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138954
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142142
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144434
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146260
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146584
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148882
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149171
Predicted Effect probably benign
Transcript: ENSMUST00000151702
SMART Domains Protein: ENSMUSP00000115919
Gene: ENSMUSG00000008682

DomainStartEndE-ValueType
Pfam:Ribosomal_L16 5 167 1.5e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184075
Meta Mutation Damage Score 0.4876 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a deoxyribonuclease protein that shows high sequence similarity to DNase I. The encoded protein is localized to the endoplasmic reticulum and modified by N-linked glycosylation. Alternate transcriptional splice variants encoding the same protein have been observed. [provided by RefSeq, Jan 2015]
PHENOTYPE: Female mice homozygous for an inactivating mutation of this gene exhibit poor motor coordination on the rotarod even on days 4 and 5 of a 5-day test. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A T 11: 110,314,552 L301Q probably damaging Het
Adgrl4 T C 3: 151,517,806 L632P probably damaging Het
Cacna2d1 T A 5: 16,322,564 I539N probably benign Het
Camta1 T A 4: 151,079,849 H314L probably damaging Het
Car2 T C 3: 14,887,965 S56P probably damaging Het
Chrm5 G A 2: 112,479,448 A441V probably damaging Het
Ckap5 T A 2: 91,596,474 N1380K possibly damaging Het
Cspg4 T C 9: 56,892,692 V1580A probably benign Het
Dcc A G 18: 71,336,035 L1099P probably damaging Het
Epha5 A T 5: 84,106,747 H644Q probably damaging Het
Eya3 T C 4: 132,672,910 I80T probably damaging Het
Fdft1 A T 14: 63,151,272 Y304N probably damaging Het
Fiz1 C T 7: 5,008,401 A373T possibly damaging Het
Gpatch2l T A 12: 86,260,605 Y252* probably null Het
Hivep1 G T 13: 42,159,671 G1796* probably null Het
Irf8 T C 8: 120,753,707 V228A probably damaging Het
Islr A C 9: 58,157,096 V376G probably damaging Het
Kdm5a T C 6: 120,382,933 V230A probably benign Het
Lpgat1 A G 1: 191,776,572 probably null Het
Lrp8 T C 4: 107,869,156 probably null Het
Lyzl4 A C 9: 121,578,084 S127A possibly damaging Het
Map4k1 T C 7: 29,000,290 V606A possibly damaging Het
Mau2 T A 8: 70,031,523 K138N probably damaging Het
Meikin T C 11: 54,370,766 L33P probably damaging Het
Mrpl28 T C 17: 26,126,278 V224A probably benign Het
Ncdn T C 4: 126,747,171 D512G possibly damaging Het
Nlrp2 T A 7: 5,300,926 Q200L possibly damaging Het
Nup98 T C 7: 102,194,750 N89S possibly damaging Het
Ogfrl1 T G 1: 23,369,863 K427N probably benign Het
Olfr1448 G T 19: 12,919,582 H242Q probably damaging Het
Olfr304 T A 7: 86,385,851 R270* probably null Het
Olfr551 A G 7: 102,588,546 C66R probably damaging Het
Olfr770 A T 10: 129,133,666 L34* probably null Het
Padi3 C T 4: 140,803,508 V68I possibly damaging Het
Pign A T 1: 105,585,095 M621K probably benign Het
Pigv C T 4: 133,665,236 V208M probably damaging Het
Ripk4 A G 16: 97,763,526 probably null Het
Rsf1 A G 7: 97,660,917 K285E probably benign Het
Serpina3k G C 12: 104,345,303 G380A probably benign Het
Sorbs1 A G 19: 40,376,982 probably null Het
Srrd G C 5: 112,340,000 A104G probably benign Het
Tbp T A 17: 15,501,089 probably null Het
Tecrl G A 5: 83,294,600 H209Y probably damaging Het
Tmprss11c A G 5: 86,256,345 L157P probably damaging Het
Tmprss13 A T 9: 45,343,200 T422S possibly damaging Het
Ttll5 A G 12: 85,956,699 H1103R probably benign Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Vldlr A G 19: 27,245,649 Y699C probably damaging Het
Vmn1r22 T G 6: 57,900,578 N138T possibly damaging Het
Other mutations in Dnase1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4691:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4752:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4753:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4814:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4815:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4846:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4861:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4862:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4872:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4873:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4875:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4978:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4979:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4980:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4981:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4982:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4983:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5039:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5084:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5085:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5086:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5087:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5106:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5107:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5108:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5109:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5137:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5171:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5266:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5296:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5330:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5417:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5418:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5419:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5448:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5450:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5466:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5467:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6126:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6128:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6129:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6130:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6232:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6233:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6234:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6242:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6305:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6306:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6329:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6344:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6396:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6397:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6449:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6450:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6585:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6586:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6646:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6679:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6681:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6845:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6847:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATTGGTACCAGAGTGGCTGC -3'
(R):5'- TTGGAGGGTTCCTGATGCAC -3'

Sequencing Primer
(F):5'- CAACATCATTCCATTATACCTTACCC -3'
(R):5'- GGTTCCTGATGCACACATAGCAATG -3'
Posted On2018-04-27