Incidental Mutation 'R6344:Abca2'
ID514035
Institutional Source Beutler Lab
Gene Symbol Abca2
Ensembl Gene ENSMUSG00000026944
Gene NameATP-binding cassette, sub-family A (ABC1), member 2
SynonymsAbc2, D2H0S1474E
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_007379.2; MGI: 99606

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6344 (G1)
Quality Score106.008
Status Not validated
Chromosome2
Chromosomal Location25428703-25448540 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 25437694 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 707 (P707L)
Ref Sequence ENSEMBL: ENSMUSP00000099983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102919]
Predicted Effect probably damaging
Transcript: ENSMUST00000102919
AA Change: P707L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099983
Gene: ENSMUSG00000026944
AA Change: P707L

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
low complexity region 119 130 N/A INTRINSIC
low complexity region 220 237 N/A INTRINSIC
coiled coil region 271 296 N/A INTRINSIC
low complexity region 309 346 N/A INTRINSIC
Pfam:ABC2_membrane_3 493 911 9.7e-18 PFAM
AAA 1015 1197 9.22e-7 SMART
low complexity region 1364 1376 N/A INTRINSIC
low complexity region 1589 1607 N/A INTRINSIC
Pfam:ABC2_membrane_3 1696 2008 2.3e-44 PFAM
AAA 2079 2264 1.12e-5 SMART
low complexity region 2375 2394 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150550
Meta Mutation Damage Score 0.74 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.3%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype Strain: 3697467; 3719855
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This protein is highly expressed in brain tissue and may play a role in macrophage lipid metabolism and neural development. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Null mice show tremors, hyperactivity, abnormal coordination, and alterations in CNS myelin sheath ultrastructure, [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bbip1 A G 19: 53,931,481 V23A probably benign Het
Bdnf A T 2: 109,723,677 Y132F probably benign Het
C4bp T C 1: 130,656,015 D72G probably benign Het
Cdcp1 T A 9: 123,182,382 K343N possibly damaging Het
Cep112 A T 11: 108,519,174 Y472F probably damaging Het
Cops2 A T 2: 125,858,979 probably benign Het
Cyp27a1 T C 1: 74,736,849 probably null Het
Dnah7a T C 1: 53,397,190 I3998V probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dnhd1 A G 7: 105,694,610 I1720M probably benign Het
Fkbpl A G 17: 34,645,570 K104R probably damaging Het
Helq G T 5: 100,766,728 A966E probably benign Het
Iba57 G A 11: 59,158,293 P350L probably damaging Het
Iqgap3 T C 3: 88,082,094 probably null Het
Kcnj9 A G 1: 172,326,146 V137A probably benign Het
Kif19a G A 11: 114,781,951 probably null Het
Kmt2a A T 9: 44,821,859 probably benign Het
Lilra5 T A 7: 4,238,786 F195I probably damaging Het
Mcm9 A G 10: 53,537,937 I349T probably benign Het
Mlst8 A G 17: 24,477,326 L143P probably damaging Het
Mrc1 T C 2: 14,244,174 F174L probably damaging Het
Muc5b T A 7: 141,862,971 L3218Q possibly damaging Het
Myo1h A G 5: 114,328,715 S275G probably damaging Het
Myo5a T A 9: 75,160,509 V615D probably benign Het
Myo9b T C 8: 71,327,914 L485P probably damaging Het
Nav1 A G 1: 135,450,796 Y1646H probably damaging Het
Nsf A T 11: 103,861,904 V539D probably damaging Het
Nutm1 A T 2: 112,248,902 N889K possibly damaging Het
Olfr133 C T 17: 38,148,720 A44V probably benign Het
Olfr543 A G 7: 102,477,531 L113P probably damaging Het
Pcdhga2 T A 18: 37,670,762 V553E probably benign Het
Pkmyt1 T C 17: 23,732,756 S95P possibly damaging Het
Ranbp2 T A 10: 58,483,886 probably null Het
Saxo2 T A 7: 82,634,865 I262F probably damaging Het
Sco1 C T 11: 67,055,745 R115W probably damaging Het
Slc27a3 G T 3: 90,387,654 Y330* probably null Het
Slc6a4 C T 11: 77,018,254 T364I probably damaging Het
Slit2 A G 5: 48,219,681 I388V probably benign Het
Smc6 C A 12: 11,297,106 probably benign Het
Snx25 C T 8: 46,035,638 W747* probably null Het
Stard9 T A 2: 120,704,320 M3686K probably benign Het
Syne1 T C 10: 5,022,212 D8732G probably benign Het
Tcaf3 A G 6: 42,597,171 S36P possibly damaging Het
Trpv6 T C 6: 41,625,422 probably null Het
Tspear T C 10: 77,875,013 F490L possibly damaging Het
Ttn A G 2: 76,721,852 I31147T probably damaging Het
Ugt3a1 A C 15: 9,306,231 E155D probably damaging Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Washc2 G T 6: 116,258,758 Q977H probably benign Het
Yars2 T A 16: 16,303,035 W18R probably benign Het
Other mutations in Abca2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Abca2 APN 2 25445963 splice site probably null
IGL01102:Abca2 APN 2 25433956 splice site probably benign
IGL01322:Abca2 APN 2 25446782 splice site probably null
IGL01402:Abca2 APN 2 25442003 missense probably damaging 1.00
IGL01419:Abca2 APN 2 25437514 missense probably damaging 1.00
IGL01490:Abca2 APN 2 25446011 missense probably damaging 1.00
IGL01633:Abca2 APN 2 25444394 missense possibly damaging 0.66
IGL01661:Abca2 APN 2 25442995 missense probably benign 0.01
IGL01804:Abca2 APN 2 25446625 missense probably damaging 1.00
IGL01933:Abca2 APN 2 25444111 missense probably damaging 1.00
IGL01941:Abca2 APN 2 25443095 missense probably benign 0.02
IGL02158:Abca2 APN 2 25447879 utr 3 prime probably benign
IGL02173:Abca2 APN 2 25441897 missense probably benign 0.00
IGL02419:Abca2 APN 2 25446837 missense probably benign
IGL02532:Abca2 APN 2 25435136 missense probably benign 0.03
IGL02572:Abca2 APN 2 25433317 missense possibly damaging 0.95
Abseiling UTSW 2 25447003 missense possibly damaging 0.65
R0126:Abca2 UTSW 2 25443730 missense possibly damaging 0.88
R0140:Abca2 UTSW 2 25438085 critical splice donor site probably null
R0372:Abca2 UTSW 2 25437353 missense probably damaging 1.00
R0437:Abca2 UTSW 2 25442845 missense probably damaging 0.99
R0505:Abca2 UTSW 2 25434894 missense probably benign 0.22
R0570:Abca2 UTSW 2 25447405 splice site probably null
R1037:Abca2 UTSW 2 25438228 splice site probably benign
R1283:Abca2 UTSW 2 25446689 missense probably damaging 1.00
R1448:Abca2 UTSW 2 25440530 missense possibly damaging 0.73
R1464:Abca2 UTSW 2 25447834 splice site probably benign
R1468:Abca2 UTSW 2 25441296 missense probably damaging 0.99
R1468:Abca2 UTSW 2 25441296 missense probably damaging 0.99
R1480:Abca2 UTSW 2 25433397 missense possibly damaging 0.60
R1545:Abca2 UTSW 2 25442358 missense probably benign 0.17
R1562:Abca2 UTSW 2 25446319 missense probably benign 0.43
R1569:Abca2 UTSW 2 25439185 missense probably benign 0.45
R1586:Abca2 UTSW 2 25447216 missense probably damaging 0.98
R1635:Abca2 UTSW 2 25444856 missense probably benign 0.03
R1699:Abca2 UTSW 2 25447351 missense possibly damaging 0.80
R1754:Abca2 UTSW 2 25434333 missense probably benign 0.01
R1760:Abca2 UTSW 2 25443043 missense probably benign 0.00
R2040:Abca2 UTSW 2 25443805 missense probably damaging 1.00
R2067:Abca2 UTSW 2 25437505 missense possibly damaging 0.88
R2111:Abca2 UTSW 2 25437505 missense possibly damaging 0.88
R2248:Abca2 UTSW 2 25433464 splice site probably benign
R2323:Abca2 UTSW 2 25445175 missense probably benign 0.00
R2418:Abca2 UTSW 2 25437989 missense probably benign 0.22
R2419:Abca2 UTSW 2 25437989 missense probably benign 0.22
R3816:Abca2 UTSW 2 25446071 missense probably damaging 1.00
R4180:Abca2 UTSW 2 25441578 missense possibly damaging 0.58
R4431:Abca2 UTSW 2 25442852 missense probably benign
R4468:Abca2 UTSW 2 25444902 missense probably damaging 1.00
R4704:Abca2 UTSW 2 25443412 missense probably damaging 0.99
R4839:Abca2 UTSW 2 25440909 missense probably damaging 0.99
R4933:Abca2 UTSW 2 25444827 missense probably benign 0.25
R4970:Abca2 UTSW 2 25438371 missense probably damaging 1.00
R4971:Abca2 UTSW 2 25441994 missense probably damaging 0.97
R5112:Abca2 UTSW 2 25438371 missense probably damaging 1.00
R5327:Abca2 UTSW 2 25445674 missense probably damaging 1.00
R5378:Abca2 UTSW 2 25446068 missense probably damaging 1.00
R5648:Abca2 UTSW 2 25436498 critical splice donor site probably null
R5725:Abca2 UTSW 2 25439400 missense probably damaging 0.98
R5825:Abca2 UTSW 2 25436736 missense probably benign 0.36
R5837:Abca2 UTSW 2 25433359 missense probably benign 0.34
R5840:Abca2 UTSW 2 25433359 missense probably benign 0.34
R5851:Abca2 UTSW 2 25442310 missense possibly damaging 0.58
R6262:Abca2 UTSW 2 25444910 missense possibly damaging 0.56
R6547:Abca2 UTSW 2 25433338 missense possibly damaging 0.80
R6640:Abca2 UTSW 2 25447003 missense possibly damaging 0.65
R6980:Abca2 UTSW 2 25440866 missense possibly damaging 0.89
R6981:Abca2 UTSW 2 25444139 missense probably damaging 1.00
R7070:Abca2 UTSW 2 25442995 missense probably benign 0.06
R7080:Abca2 UTSW 2 25446104 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- GCGCCATCATCAACACATTTG -3'
(R):5'- TCGTCTTCATCACCTGTGGG -3'

Sequencing Primer
(F):5'- CACATTTGTGGGGCATGAC -3'
(R):5'- CAGGTAGGTGGGGTAGAGAC -3'
Posted On2018-04-27