Incidental Mutation 'R6344:Iqgap3'
ID514041
Institutional Source Beutler Lab
Gene Symbol Iqgap3
Ensembl Gene ENSMUSG00000028068
Gene NameIQ motif containing GTPase activating protein 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.398) question?
Stock #R6344 (G1)
Quality Score174.009
Status Not validated
Chromosome3
Chromosomal Location88081971-88121048 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 88082094 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000071715 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050258] [ENSMUST00000071812] [ENSMUST00000195465]
Predicted Effect probably benign
Transcript: ENSMUST00000050258
SMART Domains Protein: ENSMUSP00000061571
Gene: ENSMUSG00000051036

DomainStartEndE-ValueType
TPR 35 68 3.5e0 SMART
TPR 72 105 4.09e-1 SMART
TPR 112 145 3.41e1 SMART
TPR 152 185 6.95e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000071812
SMART Domains Protein: ENSMUSP00000071715
Gene: ENSMUSG00000028068

DomainStartEndE-ValueType
CH 36 145 1.72e-14 SMART
internal_repeat_2 197 249 1.75e-5 PROSPERO
internal_repeat_1 209 418 1.31e-14 PROSPERO
low complexity region 419 438 N/A INTRINSIC
internal_repeat_1 446 651 1.31e-14 PROSPERO
internal_repeat_2 600 652 1.75e-5 PROSPERO
IQ 730 752 1.18e1 SMART
IQ 760 782 3.76e-6 SMART
IQ 790 812 3.08e-2 SMART
IQ 820 842 1.72e0 SMART
RasGAP 977 1330 1.74e-57 SMART
Blast:RasGAP 1338 1422 1e-9 BLAST
Pfam:RasGAP_C 1434 1555 2e-36 PFAM
low complexity region 1591 1602 N/A INTRINSIC
low complexity region 1615 1630 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193861
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193940
Predicted Effect probably benign
Transcript: ENSMUST00000195465
SMART Domains Protein: ENSMUSP00000142013
Gene: ENSMUSG00000028068

DomainStartEndE-ValueType
CH 36 145 8.5e-17 SMART
internal_repeat_1 209 379 1.33e-7 PROSPERO
low complexity region 419 438 N/A INTRINSIC
internal_repeat_1 446 612 1.33e-7 PROSPERO
Meta Mutation Damage Score 0.524 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.3%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 C T 2: 25,437,694 P707L probably damaging Het
Bbip1 A G 19: 53,931,481 V23A probably benign Het
Bdnf A T 2: 109,723,677 Y132F probably benign Het
C4bp T C 1: 130,656,015 D72G probably benign Het
Cdcp1 T A 9: 123,182,382 K343N possibly damaging Het
Cep112 A T 11: 108,519,174 Y472F probably damaging Het
Cops2 A T 2: 125,858,979 probably benign Het
Cyp27a1 T C 1: 74,736,849 probably null Het
Dnah7a T C 1: 53,397,190 I3998V probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dnhd1 A G 7: 105,694,610 I1720M probably benign Het
Fkbpl A G 17: 34,645,570 K104R probably damaging Het
Helq G T 5: 100,766,728 A966E probably benign Het
Iba57 G A 11: 59,158,293 P350L probably damaging Het
Kcnj9 A G 1: 172,326,146 V137A probably benign Het
Kif19a G A 11: 114,781,951 probably null Het
Kmt2a A T 9: 44,821,859 probably benign Het
Lilra5 T A 7: 4,238,786 F195I probably damaging Het
Mcm9 A G 10: 53,537,937 I349T probably benign Het
Mlst8 A G 17: 24,477,326 L143P probably damaging Het
Mrc1 T C 2: 14,244,174 F174L probably damaging Het
Muc5b T A 7: 141,862,971 L3218Q possibly damaging Het
Myo1h A G 5: 114,328,715 S275G probably damaging Het
Myo5a T A 9: 75,160,509 V615D probably benign Het
Myo9b T C 8: 71,327,914 L485P probably damaging Het
Nav1 A G 1: 135,450,796 Y1646H probably damaging Het
Nsf A T 11: 103,861,904 V539D probably damaging Het
Nutm1 A T 2: 112,248,902 N889K possibly damaging Het
Olfr133 C T 17: 38,148,720 A44V probably benign Het
Olfr543 A G 7: 102,477,531 L113P probably damaging Het
Pcdhga2 T A 18: 37,670,762 V553E probably benign Het
Pkmyt1 T C 17: 23,732,756 S95P possibly damaging Het
Ranbp2 T A 10: 58,483,886 probably null Het
Saxo2 T A 7: 82,634,865 I262F probably damaging Het
Sco1 C T 11: 67,055,745 R115W probably damaging Het
Slc27a3 G T 3: 90,387,654 Y330* probably null Het
Slc6a4 C T 11: 77,018,254 T364I probably damaging Het
Slit2 A G 5: 48,219,681 I388V probably benign Het
Smc6 C A 12: 11,297,106 probably benign Het
Snx25 C T 8: 46,035,638 W747* probably null Het
Stard9 T A 2: 120,704,320 M3686K probably benign Het
Syne1 T C 10: 5,022,212 D8732G probably benign Het
Tcaf3 A G 6: 42,597,171 S36P possibly damaging Het
Trpv6 T C 6: 41,625,422 probably null Het
Tspear T C 10: 77,875,013 F490L possibly damaging Het
Ttn A G 2: 76,721,852 I31147T probably damaging Het
Ugt3a1 A C 15: 9,306,231 E155D probably damaging Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Washc2 G T 6: 116,258,758 Q977H probably benign Het
Yars2 T A 16: 16,303,035 W18R probably benign Het
Other mutations in Iqgap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01016:Iqgap3 APN 3 88107560 missense probably damaging 1.00
IGL01062:Iqgap3 APN 3 88110122 missense probably benign 0.00
IGL01517:Iqgap3 APN 3 88109396 missense probably benign 0.09
IGL01530:Iqgap3 APN 3 88112303 critical splice acceptor site probably null
IGL01658:Iqgap3 APN 3 88115971 missense possibly damaging 0.89
IGL02027:Iqgap3 APN 3 88087342 missense possibly damaging 0.67
IGL02352:Iqgap3 APN 3 88101960 missense probably benign 0.00
IGL02359:Iqgap3 APN 3 88101960 missense probably benign 0.00
IGL02522:Iqgap3 APN 3 88108398 missense possibly damaging 0.94
IGL02717:Iqgap3 APN 3 88098359 missense probably benign 0.01
IGL02971:Iqgap3 APN 3 88090304 missense probably benign 0.30
IGL03079:Iqgap3 APN 3 88113170 missense probably benign
IGL03240:Iqgap3 APN 3 88114974 missense probably benign 0.00
adjutant UTSW 3 88101527 missense possibly damaging 0.51
booster UTSW 3 88113128 missense probably damaging 0.99
R0048:Iqgap3 UTSW 3 88115949 missense probably benign 0.00
R0048:Iqgap3 UTSW 3 88115949 missense probably benign 0.00
R0285:Iqgap3 UTSW 3 88096990 missense probably benign 0.11
R0442:Iqgap3 UTSW 3 88115959 missense probably damaging 0.96
R0490:Iqgap3 UTSW 3 88114056 splice site probably benign
R0569:Iqgap3 UTSW 3 88090725 splice site probably benign
R0747:Iqgap3 UTSW 3 88107503 splice site probably benign
R0843:Iqgap3 UTSW 3 88108431 missense possibly damaging 0.94
R1260:Iqgap3 UTSW 3 88114023 missense probably benign
R1465:Iqgap3 UTSW 3 88087309 missense probably damaging 0.99
R1465:Iqgap3 UTSW 3 88087309 missense probably damaging 0.99
R1544:Iqgap3 UTSW 3 88098893 missense probably benign 0.00
R1662:Iqgap3 UTSW 3 88098401 missense probably benign 0.33
R1686:Iqgap3 UTSW 3 88108356 splice site probably benign
R1748:Iqgap3 UTSW 3 88113980 missense possibly damaging 0.92
R1836:Iqgap3 UTSW 3 88108368 missense probably damaging 1.00
R1972:Iqgap3 UTSW 3 88083928 splice site probably null
R1973:Iqgap3 UTSW 3 88083928 splice site probably null
R2051:Iqgap3 UTSW 3 88120167 missense probably damaging 1.00
R2314:Iqgap3 UTSW 3 88116031 missense probably benign 0.01
R2352:Iqgap3 UTSW 3 88104508 missense possibly damaging 0.94
R2857:Iqgap3 UTSW 3 88107596 nonsense probably null
R2859:Iqgap3 UTSW 3 88107596 nonsense probably null
R3435:Iqgap3 UTSW 3 88094604 missense probably benign 0.00
R3522:Iqgap3 UTSW 3 88090782 missense probably null 0.90
R4281:Iqgap3 UTSW 3 88098860 missense probably benign 0.19
R4283:Iqgap3 UTSW 3 88098860 missense probably benign 0.19
R4397:Iqgap3 UTSW 3 88104358 missense probably damaging 1.00
R4414:Iqgap3 UTSW 3 88096986 missense probably benign
R4660:Iqgap3 UTSW 3 88120176 missense probably damaging 1.00
R4872:Iqgap3 UTSW 3 88113128 missense probably damaging 0.99
R4883:Iqgap3 UTSW 3 88107535 missense probably benign
R4915:Iqgap3 UTSW 3 88101527 missense possibly damaging 0.51
R5050:Iqgap3 UTSW 3 88090186 missense probably damaging 1.00
R5130:Iqgap3 UTSW 3 88108854 missense probably damaging 0.97
R5151:Iqgap3 UTSW 3 88117760 missense possibly damaging 0.58
R5645:Iqgap3 UTSW 3 88117699 missense probably damaging 1.00
R5706:Iqgap3 UTSW 3 88115908 missense probably benign 0.03
R5748:Iqgap3 UTSW 3 88109370 missense probably damaging 1.00
R5880:Iqgap3 UTSW 3 88117202 missense possibly damaging 0.67
R5982:Iqgap3 UTSW 3 88091592 nonsense probably null
R6006:Iqgap3 UTSW 3 88091547 missense probably damaging 0.98
R6026:Iqgap3 UTSW 3 88090171 missense probably damaging 1.00
R6188:Iqgap3 UTSW 3 88098893 missense probably benign 0.00
R6211:Iqgap3 UTSW 3 88091515 missense probably benign
R6291:Iqgap3 UTSW 3 88089730 critical splice donor site probably null
R6854:Iqgap3 UTSW 3 88096951 missense probably damaging 1.00
R6875:Iqgap3 UTSW 3 88112771 frame shift probably null
R6877:Iqgap3 UTSW 3 88112771 frame shift probably null
R6958:Iqgap3 UTSW 3 88113366 missense possibly damaging 0.89
R7008:Iqgap3 UTSW 3 88112771 frame shift probably null
R7050:Iqgap3 UTSW 3 88098913 missense probably damaging 1.00
R7144:Iqgap3 UTSW 3 88116910 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTAGCTCACGATCTCTAAGAG -3'
(R):5'- ACTGCTGAGTTTTAAGGGGCC -3'

Sequencing Primer
(F):5'- GCTCACGATCTCTAAGAGGAACTAC -3'
(R):5'- GGGGCCATTTAGATCATCTAGACTC -3'
Posted On2018-04-27