Incidental Mutation 'R6344:Kif19a'
ID514069
Institutional Source Beutler Lab
Gene Symbol Kif19a
Ensembl Gene ENSMUSG00000010021
Gene Namekinesin family member 19A
SynonymsN-8 kinesin
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R6344 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location114765388-114790739 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 114781951 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115663 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084368] [ENSMUST00000138804]
Predicted Effect probably null
Transcript: ENSMUST00000084368
SMART Domains Protein: ENSMUSP00000081398
Gene: ENSMUSG00000010021

DomainStartEndE-ValueType
KISc 9 354 4.53e-150 SMART
coiled coil region 361 388 N/A INTRINSIC
coiled coil region 431 449 N/A INTRINSIC
coiled coil region 506 551 N/A INTRINSIC
low complexity region 628 641 N/A INTRINSIC
low complexity region 750 766 N/A INTRINSIC
low complexity region 807 815 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126555
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131782
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137326
Predicted Effect probably null
Transcript: ENSMUST00000138804
SMART Domains Protein: ENSMUSP00000115663
Gene: ENSMUSG00000010021

DomainStartEndE-ValueType
KISc 9 312 2.99e-118 SMART
coiled coil region 319 346 N/A INTRINSIC
coiled coil region 389 407 N/A INTRINSIC
coiled coil region 464 509 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
low complexity region 683 692 N/A INTRINSIC
Meta Mutation Damage Score 0.53 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.3%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display partial postnatal lethality, hydroencephaly, female infertility, oviduct obstruction, increased motile cilium length and impaired motile cilium movement. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 C T 2: 25,437,694 P707L probably damaging Het
Bbip1 A G 19: 53,931,481 V23A probably benign Het
Bdnf A T 2: 109,723,677 Y132F probably benign Het
C4bp T C 1: 130,656,015 D72G probably benign Het
Cdcp1 T A 9: 123,182,382 K343N possibly damaging Het
Cep112 A T 11: 108,519,174 Y472F probably damaging Het
Cops2 A T 2: 125,858,979 probably benign Het
Cyp27a1 T C 1: 74,736,849 probably null Het
Dnah7a T C 1: 53,397,190 I3998V probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dnhd1 A G 7: 105,694,610 I1720M probably benign Het
Fkbpl A G 17: 34,645,570 K104R probably damaging Het
Helq G T 5: 100,766,728 A966E probably benign Het
Iba57 G A 11: 59,158,293 P350L probably damaging Het
Iqgap3 T C 3: 88,082,094 probably null Het
Kcnj9 A G 1: 172,326,146 V137A probably benign Het
Kmt2a A T 9: 44,821,859 probably benign Het
Lilra5 T A 7: 4,238,786 F195I probably damaging Het
Mcm9 A G 10: 53,537,937 I349T probably benign Het
Mlst8 A G 17: 24,477,326 L143P probably damaging Het
Mrc1 T C 2: 14,244,174 F174L probably damaging Het
Muc5b T A 7: 141,862,971 L3218Q possibly damaging Het
Myo1h A G 5: 114,328,715 S275G probably damaging Het
Myo5a T A 9: 75,160,509 V615D probably benign Het
Myo9b T C 8: 71,327,914 L485P probably damaging Het
Nav1 A G 1: 135,450,796 Y1646H probably damaging Het
Nsf A T 11: 103,861,904 V539D probably damaging Het
Nutm1 A T 2: 112,248,902 N889K possibly damaging Het
Olfr133 C T 17: 38,148,720 A44V probably benign Het
Olfr543 A G 7: 102,477,531 L113P probably damaging Het
Pcdhga2 T A 18: 37,670,762 V553E probably benign Het
Pkmyt1 T C 17: 23,732,756 S95P possibly damaging Het
Ranbp2 T A 10: 58,483,886 probably null Het
Saxo2 T A 7: 82,634,865 I262F probably damaging Het
Sco1 C T 11: 67,055,745 R115W probably damaging Het
Slc27a3 G T 3: 90,387,654 Y330* probably null Het
Slc6a4 C T 11: 77,018,254 T364I probably damaging Het
Slit2 A G 5: 48,219,681 I388V probably benign Het
Smc6 C A 12: 11,297,106 probably benign Het
Snx25 C T 8: 46,035,638 W747* probably null Het
Stard9 T A 2: 120,704,320 M3686K probably benign Het
Syne1 T C 10: 5,022,212 D8732G probably benign Het
Tcaf3 A G 6: 42,597,171 S36P possibly damaging Het
Trpv6 T C 6: 41,625,422 probably null Het
Tspear T C 10: 77,875,013 F490L possibly damaging Het
Ttn A G 2: 76,721,852 I31147T probably damaging Het
Ugt3a1 A C 15: 9,306,231 E155D probably damaging Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Washc2 G T 6: 116,258,758 Q977H probably benign Het
Yars2 T A 16: 16,303,035 W18R probably benign Het
Other mutations in Kif19a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Kif19a APN 11 114779585 missense probably damaging 1.00
IGL00743:Kif19a APN 11 114784773 missense probably damaging 1.00
IGL00763:Kif19a APN 11 114767168 missense probably benign 0.00
IGL01327:Kif19a APN 11 114781799 splice site probably benign
IGL02422:Kif19a APN 11 114789361 missense probably damaging 1.00
IGL02481:Kif19a APN 11 114789153 missense probably benign 0.28
IGL02496:Kif19a APN 11 114779644 missense probably damaging 0.99
IGL02735:Kif19a APN 11 114785567 missense probably damaging 1.00
IGL02830:Kif19a APN 11 114781208 missense probably damaging 1.00
IGL02902:Kif19a APN 11 114785570 missense possibly damaging 0.46
IGL03372:Kif19a APN 11 114779218 missense probably damaging 0.99
PIT4520001:Kif19a UTSW 11 114781208 missense probably damaging 1.00
R0212:Kif19a UTSW 11 114784910 missense possibly damaging 0.48
R0383:Kif19a UTSW 11 114765514 start codon destroyed possibly damaging 0.63
R0850:Kif19a UTSW 11 114780787 missense probably damaging 0.99
R1343:Kif19a UTSW 11 114785827 missense probably benign 0.08
R1422:Kif19a UTSW 11 114785809 missense probably benign 0.01
R1547:Kif19a UTSW 11 114786572 missense probably benign 0.41
R1591:Kif19a UTSW 11 114789231 missense probably benign
R2148:Kif19a UTSW 11 114780768 missense probably damaging 1.00
R2291:Kif19a UTSW 11 114790193 missense probably damaging 1.00
R3814:Kif19a UTSW 11 114781919 missense probably damaging 1.00
R3944:Kif19a UTSW 11 114786735 missense probably benign 0.34
R4631:Kif19a UTSW 11 114784847 missense possibly damaging 0.95
R4866:Kif19a UTSW 11 114767227 missense probably benign 0.00
R4867:Kif19a UTSW 11 114767227 missense probably benign 0.00
R5022:Kif19a UTSW 11 114767227 missense probably benign 0.00
R5071:Kif19a UTSW 11 114767227 missense probably benign 0.00
R5072:Kif19a UTSW 11 114767227 missense probably benign 0.00
R5073:Kif19a UTSW 11 114767227 missense probably benign 0.00
R5074:Kif19a UTSW 11 114767227 missense probably benign 0.00
R5091:Kif19a UTSW 11 114783097 missense probably damaging 1.00
R5640:Kif19a UTSW 11 114779215 missense probably benign 0.25
R5646:Kif19a UTSW 11 114779654 missense probably damaging 1.00
R5786:Kif19a UTSW 11 114779223 nonsense probably null
R5890:Kif19a UTSW 11 114789438 missense possibly damaging 0.92
R6522:Kif19a UTSW 11 114785779 missense probably damaging 1.00
R6570:Kif19a UTSW 11 114784905 missense possibly damaging 0.63
R6879:Kif19a UTSW 11 114781333 missense probably benign 0.03
R7028:Kif19a UTSW 11 114781208 missense probably damaging 1.00
R7274:Kif19a UTSW 11 114765455 start gained probably benign
R7492:Kif19a UTSW 11 114790239 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- GAGGCCATGCTCTATAACCAGG -3'
(R):5'- AGAGAACGTCTGCTTGCGAC -3'

Sequencing Primer
(F):5'- GCCATGCTCTATAACCAGGATCAC -3'
(R):5'- CGTCTGCTTGCGACAAAAATTTCAG -3'
Posted On2018-04-27