Incidental Mutation 'R6345:Olfr1055'
ID514087
Institutional Source Beutler Lab
Gene Symbol Olfr1055
Ensembl Gene ENSMUSG00000075189
Gene Nameolfactory receptor 1055
SynonymsMOR186-1, GA_x6K02T2Q125-47819205-47818258
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R6345 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location86346624-86350284 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86347548 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 73 (Y73H)
Ref Sequence ENSEMBL: ENSMUSP00000140847 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099894] [ENSMUST00000188023] [ENSMUST00000213564]
Predicted Effect probably benign
Transcript: ENSMUST00000099894
AA Change: Y73H

PolyPhen 2 Score 0.350 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000097479
Gene: ENSMUSG00000075189
AA Change: Y73H

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 7.3e-49 PFAM
Pfam:7tm_1 41 290 1.3e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000188023
AA Change: Y73H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140847
Gene: ENSMUSG00000075189
AA Change: Y73H

DomainStartEndE-ValueType
Pfam:7tm_1 41 290 5.7e-30 PFAM
Pfam:7tm_4 139 283 9.2e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213564
AA Change: Y73H

PolyPhen 2 Score 0.350 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T C 10: 87,226,051 I121T probably benign Het
4921524L21Rik T A 18: 6,626,399 M137K possibly damaging Het
Angpt4 C A 2: 151,929,434 N223K probably benign Het
Ankrd6 T C 4: 32,810,266 R437G probably damaging Het
Atp9a C T 2: 168,676,173 S264N probably damaging Het
AY358078 A C 14: 51,826,292 Y465S probably damaging Het
Bin3 G A 14: 70,137,227 R235Q probably benign Het
Bsn G A 9: 108,107,355 P3167S unknown Het
Camk2g G A 14: 20,737,375 R274C probably damaging Het
Ccdc61 A T 7: 18,909,989 probably null Het
Ccnjl A T 11: 43,585,338 T263S probably benign Het
Col17a1 G T 19: 47,653,379 P944T possibly damaging Het
Cyp2c39 A T 19: 39,513,171 probably null Het
Cyp2c39 G T 19: 39,513,172 probably null Het
Cyp4a32 T C 4: 115,602,363 V98A possibly damaging Het
D430042O09Rik C A 7: 125,752,987 D26E probably damaging Het
Dnah9 A G 11: 66,037,693 V2050A probably damaging Het
F5 A G 1: 164,191,951 N665S probably benign Het
Fbxl6 A T 15: 76,535,854 C520S probably damaging Het
Fscn2 C A 11: 120,362,027 H107N probably damaging Het
Gfm2 C T 13: 97,162,953 T367M probably damaging Het
Gle1 C G 2: 29,936,115 P69A probably benign Het
Gpr156 A T 16: 37,987,519 D176V probably damaging Het
Grip2 A G 6: 91,765,388 S895P possibly damaging Het
Hfm1 C T 5: 106,841,638 G1404D probably benign Het
Ifit1bl1 G A 19: 34,594,170 R296* probably null Het
Ighv1-39 C T 12: 114,914,859 V31M possibly damaging Het
Itgav A G 2: 83,802,036 E956G probably damaging Het
Lsm8 A G 6: 18,853,645 D86G probably damaging Het
Mdh1b T G 1: 63,715,239 H390P possibly damaging Het
Mtrf1l A T 10: 5,817,468 I216N possibly damaging Het
Muc16 G A 9: 18,654,926 T2099I unknown Het
Myh7 T C 14: 54,983,692 R925G probably damaging Het
Myo1h T A 5: 114,351,708 I658N probably damaging Het
Myo5a A T 9: 75,189,913 D81V possibly damaging Het
Nell1 G A 7: 49,975,423 C12Y possibly damaging Het
Obscn T C 11: 59,053,696 Y4724C probably damaging Het
Pah G A 10: 87,576,187 D315N probably damaging Het
Per2 A G 1: 91,448,722 V143A probably damaging Het
Plcxd1 T C 5: 110,100,299 V38A probably benign Het
Pld1 A G 3: 28,130,747 probably benign Het
Plekhh2 A G 17: 84,575,787 N761S probably benign Het
Polh T C 17: 46,182,738 I318V probably benign Het
Prex1 T C 2: 166,572,960 Q1323R probably null Het
Rb1cc1 T A 1: 6,263,257 S1440T probably benign Het
Rbm19 G T 5: 120,127,040 W382L possibly damaging Het
Rchy1 T C 5: 91,957,942 D49G probably benign Het
Ric1 A G 19: 29,604,085 D1402G probably benign Het
S1pr3 G T 13: 51,419,031 A83S probably damaging Het
S1pr3 C A 13: 51,419,032 A83D probably damaging Het
Selplg G A 5: 113,820,149 P32L probably benign Het
Serpinb9c T C 13: 33,149,995 R355G probably damaging Het
Slx4 G C 16: 3,990,850 Q409E probably benign Het
Sntg1 A C 1: 8,583,284 L243R possibly damaging Het
Specc1l G T 10: 75,248,488 D682Y probably damaging Het
Spen C T 4: 141,471,633 V3228I possibly damaging Het
Strip1 T C 3: 107,628,200 E69G probably damaging Het
Tasp1 C A 2: 139,951,537 V240L probably damaging Het
Tdrd9 T A 12: 112,034,608 F787L probably damaging Het
Vmn1r228 A G 17: 20,776,882 S125P probably damaging Het
Wdhd1 A G 14: 47,251,922 M718T probably damaging Het
Other mutations in Olfr1055
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Olfr1055 APN 2 86347733 missense possibly damaging 0.71
IGL02524:Olfr1055 APN 2 86347342 missense probably damaging 1.00
R0123:Olfr1055 UTSW 2 86347728 missense possibly damaging 0.46
R0134:Olfr1055 UTSW 2 86347728 missense possibly damaging 0.46
R0225:Olfr1055 UTSW 2 86347728 missense possibly damaging 0.46
R1981:Olfr1055 UTSW 2 86347142 missense possibly damaging 0.94
R4181:Olfr1055 UTSW 2 86347237 missense probably damaging 1.00
R5011:Olfr1055 UTSW 2 86347303 missense probably benign 0.00
R5013:Olfr1055 UTSW 2 86347303 missense probably benign 0.00
R5077:Olfr1055 UTSW 2 86347339 missense probably benign 0.00
R6312:Olfr1055 UTSW 2 86347581 missense probably damaging 1.00
R6591:Olfr1055 UTSW 2 86347419 missense probably damaging 1.00
R6626:Olfr1055 UTSW 2 86347020 missense possibly damaging 0.81
R6680:Olfr1055 UTSW 2 86347245 missense probably damaging 1.00
R6691:Olfr1055 UTSW 2 86347419 missense probably damaging 1.00
R7447:Olfr1055 UTSW 2 86346806 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- GTAAGGTATTGCCACCAGAACATG -3'
(R):5'- AATCACAGATCTCCCTGAACTG -3'

Sequencing Primer
(F):5'- GCCACCAGAACATGACATAATCTTTG -3'
(R):5'- GAACTGCAGGCCCCTTTATTTGG -3'
Posted On2018-04-27