Incidental Mutation 'R6345:Plcxd1'
ID514099
Institutional Source Beutler Lab
Gene Symbol Plcxd1
Ensembl Gene ENSMUSG00000064247
Gene Namephosphatidylinositol-specific phospholipase C, X domain containing 1
SynonymsA330045H12Rik, LOC231597
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R6345 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location110099969-110105953 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 110100299 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 38 (V38A)
Ref Sequence ENSEMBL: ENSMUSP00000083892 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077220] [ENSMUST00000086687] [ENSMUST00000112534] [ENSMUST00000135409] [ENSMUST00000141066]
Predicted Effect probably benign
Transcript: ENSMUST00000077220
SMART Domains Protein: ENSMUSP00000076458
Gene: ENSMUSG00000033434

DomainStartEndE-ValueType
low complexity region 50 83 N/A INTRINSIC
Pfam:GTP-bdg_N 107 198 9.1e-15 PFAM
Pfam:GTP-bdg_M 200 279 1.9e-17 PFAM
Pfam:MMR_HSR1 286 404 3.1e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000086687
AA Change: V38A

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000083892
Gene: ENSMUSG00000064247
AA Change: V38A

DomainStartEndE-ValueType
SCOP:d2ptd__ 48 355 1e-70 SMART
PDB:1AOD|A 57 228 1e-12 PDB
Blast:PLCXc 70 228 8e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000112534
SMART Domains Protein: ENSMUSP00000108153
Gene: ENSMUSG00000064247

DomainStartEndE-ValueType
SCOP:d2ptd__ 1 111 2e-21 SMART
PDB:1AOD|A 7 95 3e-6 PDB
Blast:PLCXc 15 121 4e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125748
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127628
Predicted Effect probably benign
Transcript: ENSMUST00000135409
SMART Domains Protein: ENSMUSP00000117817
Gene: ENSMUSG00000033434

DomainStartEndE-ValueType
low complexity region 162 173 N/A INTRINSIC
coiled coil region 185 218 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138507
Predicted Effect probably benign
Transcript: ENSMUST00000141066
SMART Domains Protein: ENSMUSP00000119248
Gene: ENSMUSG00000064247

DomainStartEndE-ValueType
SCOP:d2ptd__ 1 97 6e-20 SMART
PDB:1AOD|A 7 95 3e-6 PDB
Blast:PLCXc 15 99 5e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199496
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T C 10: 87,226,051 I121T probably benign Het
4921524L21Rik T A 18: 6,626,399 M137K possibly damaging Het
Angpt4 C A 2: 151,929,434 N223K probably benign Het
Ankrd6 T C 4: 32,810,266 R437G probably damaging Het
Atp9a C T 2: 168,676,173 S264N probably damaging Het
AY358078 A C 14: 51,826,292 Y465S probably damaging Het
Bin3 G A 14: 70,137,227 R235Q probably benign Het
Bsn G A 9: 108,107,355 P3167S unknown Het
Camk2g G A 14: 20,737,375 R274C probably damaging Het
Ccdc61 A T 7: 18,909,989 probably null Het
Ccnjl A T 11: 43,585,338 T263S probably benign Het
Col17a1 G T 19: 47,653,379 P944T possibly damaging Het
Cyp2c39 A T 19: 39,513,171 probably null Het
Cyp2c39 G T 19: 39,513,172 probably null Het
Cyp4a32 T C 4: 115,602,363 V98A possibly damaging Het
D430042O09Rik C A 7: 125,752,987 D26E probably damaging Het
Dnah9 A G 11: 66,037,693 V2050A probably damaging Het
F5 A G 1: 164,191,951 N665S probably benign Het
Fbxl6 A T 15: 76,535,854 C520S probably damaging Het
Fscn2 C A 11: 120,362,027 H107N probably damaging Het
Gfm2 C T 13: 97,162,953 T367M probably damaging Het
Gle1 C G 2: 29,936,115 P69A probably benign Het
Gpr156 A T 16: 37,987,519 D176V probably damaging Het
Grip2 A G 6: 91,765,388 S895P possibly damaging Het
Hfm1 C T 5: 106,841,638 G1404D probably benign Het
Ifit1bl1 G A 19: 34,594,170 R296* probably null Het
Ighv1-39 C T 12: 114,914,859 V31M possibly damaging Het
Itgav A G 2: 83,802,036 E956G probably damaging Het
Lsm8 A G 6: 18,853,645 D86G probably damaging Het
Mdh1b T G 1: 63,715,239 H390P possibly damaging Het
Mtrf1l A T 10: 5,817,468 I216N possibly damaging Het
Muc16 G A 9: 18,654,926 T2099I unknown Het
Myh7 T C 14: 54,983,692 R925G probably damaging Het
Myo1h T A 5: 114,351,708 I658N probably damaging Het
Myo5a A T 9: 75,189,913 D81V possibly damaging Het
Nell1 G A 7: 49,975,423 C12Y possibly damaging Het
Obscn T C 11: 59,053,696 Y4724C probably damaging Het
Olfr1055 A G 2: 86,347,548 Y73H probably damaging Het
Pah G A 10: 87,576,187 D315N probably damaging Het
Per2 A G 1: 91,448,722 V143A probably damaging Het
Pld1 A G 3: 28,130,747 probably benign Het
Plekhh2 A G 17: 84,575,787 N761S probably benign Het
Polh T C 17: 46,182,738 I318V probably benign Het
Prex1 T C 2: 166,572,960 Q1323R probably null Het
Rb1cc1 T A 1: 6,263,257 S1440T probably benign Het
Rbm19 G T 5: 120,127,040 W382L possibly damaging Het
Rchy1 T C 5: 91,957,942 D49G probably benign Het
Ric1 A G 19: 29,604,085 D1402G probably benign Het
S1pr3 G T 13: 51,419,031 A83S probably damaging Het
S1pr3 C A 13: 51,419,032 A83D probably damaging Het
Selplg G A 5: 113,820,149 P32L probably benign Het
Serpinb9c T C 13: 33,149,995 R355G probably damaging Het
Slx4 G C 16: 3,990,850 Q409E probably benign Het
Sntg1 A C 1: 8,583,284 L243R possibly damaging Het
Specc1l G T 10: 75,248,488 D682Y probably damaging Het
Spen C T 4: 141,471,633 V3228I possibly damaging Het
Strip1 T C 3: 107,628,200 E69G probably damaging Het
Tasp1 C A 2: 139,951,537 V240L probably damaging Het
Tdrd9 T A 12: 112,034,608 F787L probably damaging Het
Vmn1r228 A G 17: 20,776,882 S125P probably damaging Het
Wdhd1 A G 14: 47,251,922 M718T probably damaging Het
Other mutations in Plcxd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01776:Plcxd1 APN 5 110101380 splice site probably benign
IGL02268:Plcxd1 APN 5 110100274 unclassified probably benign
IGL02870:Plcxd1 APN 5 110101405 missense probably damaging 1.00
R0066:Plcxd1 UTSW 5 110101502 missense probably damaging 1.00
R1366:Plcxd1 UTSW 5 110102230 missense probably damaging 1.00
R1912:Plcxd1 UTSW 5 110103442 missense probably benign 0.01
R2698:Plcxd1 UTSW 5 110102483 missense probably benign 0.31
R5135:Plcxd1 UTSW 5 110101363 intron probably benign
R5604:Plcxd1 UTSW 5 110102585 missense probably benign 0.00
R6190:Plcxd1 UTSW 5 110102603 missense probably damaging 1.00
R6351:Plcxd1 UTSW 5 110102167 splice site probably null
R6696:Plcxd1 UTSW 5 110101885 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GCATGACTTAACTGCGCTGG -3'
(R):5'- TGTTCAGTCACTGACCTGCG -3'

Sequencing Primer
(F):5'- GACACGGTGCCTCAGTTTC -3'
(R):5'- CGGGTGTTCACGTGAGAC -3'
Posted On2018-04-27