Incidental Mutation 'R6345:Gfm2'
ID514124
Institutional Source Beutler Lab
Gene Symbol Gfm2
Ensembl Gene ENSMUSG00000021666
Gene NameG elongation factor, mitochondrial 2
SynonymsEFG2, MST027, A930009M04Rik, 6530419G12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.574) question?
Stock #R6345 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location97137937-97181195 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 97162953 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 367 (T367M)
Ref Sequence ENSEMBL: ENSMUSP00000048373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022170] [ENSMUST00000042084] [ENSMUST00000161639] [ENSMUST00000161825] [ENSMUST00000161913]
Predicted Effect probably benign
Transcript: ENSMUST00000022170
AA Change: T392M

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000022170
Gene: ENSMUSG00000021666
AA Change: T392M

DomainStartEndE-ValueType
Pfam:GTP_EFTU 66 349 9.9e-64 PFAM
Pfam:GTP_EFTU_D2 379 446 4.3e-8 PFAM
low complexity region 447 473 N/A INTRINSIC
Pfam:EFG_II 482 556 3.9e-29 PFAM
EFG_IV 558 677 2.94e-17 SMART
EFG_C 679 766 1.9e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000042084
AA Change: T367M

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000048373
Gene: ENSMUSG00000021666
AA Change: T367M

DomainStartEndE-ValueType
Pfam:GTP_EFTU 68 324 4.6e-64 PFAM
Pfam:GTP_EFTU_D2 354 421 4.2e-8 PFAM
low complexity region 422 448 N/A INTRINSIC
Pfam:EFG_II 457 531 3.7e-29 PFAM
EFG_IV 533 652 2.94e-17 SMART
EFG_C 654 741 1.9e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160981
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160989
Predicted Effect possibly damaging
Transcript: ENSMUST00000161639
AA Change: T394M

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000125656
Gene: ENSMUSG00000021666
AA Change: T394M

DomainStartEndE-ValueType
Pfam:GTP_EFTU 68 351 1.2e-68 PFAM
low complexity region 449 475 N/A INTRINSIC
Pfam:EFG_II 484 558 4.5e-30 PFAM
EFG_IV 560 679 2.94e-17 SMART
EFG_C 681 768 1.9e-20 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000161825
AA Change: T394M

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000125088
Gene: ENSMUSG00000021666
AA Change: T394M

DomainStartEndE-ValueType
Pfam:GTP_EFTU 68 351 2.3e-64 PFAM
Pfam:GTP_EFTU_D2 381 448 1.1e-8 PFAM
low complexity region 449 475 N/A INTRINSIC
Pfam:EFG_II 484 558 7.1e-30 PFAM
EFG_IV 560 679 2.94e-17 SMART
EFG_C 681 738 3.46e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161843
Predicted Effect possibly damaging
Transcript: ENSMUST00000161913
AA Change: T394M

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124253
Gene: ENSMUSG00000021666
AA Change: T394M

DomainStartEndE-ValueType
Pfam:GTP_EFTU 68 351 3.3e-64 PFAM
Pfam:GTP_EFTU_D2 381 448 3.2e-8 PFAM
low complexity region 449 475 N/A INTRINSIC
Pfam:EFG_II 484 532 2.1e-13 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Eukaryotes contain two protein translational systems, one in the cytoplasm and one in the mitochondria. Mitochondrial translation is crucial for maintaining mitochondrial function and mutations in this system lead to a breakdown in the respiratory chain-oxidative phosphorylation system and to impaired maintenance of mitochondrial DNA. This gene encodes one of the mitochondrial translation elongation factors, which is a GTPase that plays a role at the termination of mitochondrial translation by mediating the disassembly of ribosomes from messenger RNA . Its role in the regulation of normal mitochondrial function and in disease states attributed to mitochondrial dysfunction is not known. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T C 10: 87,226,051 I121T probably benign Het
4921524L21Rik T A 18: 6,626,399 M137K possibly damaging Het
Angpt4 C A 2: 151,929,434 N223K probably benign Het
Ankrd6 T C 4: 32,810,266 R437G probably damaging Het
Atp9a C T 2: 168,676,173 S264N probably damaging Het
AY358078 A C 14: 51,826,292 Y465S probably damaging Het
Bin3 G A 14: 70,137,227 R235Q probably benign Het
Bsn G A 9: 108,107,355 P3167S unknown Het
Camk2g G A 14: 20,737,375 R274C probably damaging Het
Ccdc61 A T 7: 18,909,989 probably null Het
Ccnjl A T 11: 43,585,338 T263S probably benign Het
Col17a1 G T 19: 47,653,379 P944T possibly damaging Het
Cyp2c39 A T 19: 39,513,171 probably null Het
Cyp2c39 G T 19: 39,513,172 probably null Het
Cyp4a32 T C 4: 115,602,363 V98A possibly damaging Het
D430042O09Rik C A 7: 125,752,987 D26E probably damaging Het
Dnah9 A G 11: 66,037,693 V2050A probably damaging Het
F5 A G 1: 164,191,951 N665S probably benign Het
Fbxl6 A T 15: 76,535,854 C520S probably damaging Het
Fscn2 C A 11: 120,362,027 H107N probably damaging Het
Gle1 C G 2: 29,936,115 P69A probably benign Het
Gpr156 A T 16: 37,987,519 D176V probably damaging Het
Grip2 A G 6: 91,765,388 S895P possibly damaging Het
Hfm1 C T 5: 106,841,638 G1404D probably benign Het
Ifit1bl1 G A 19: 34,594,170 R296* probably null Het
Ighv1-39 C T 12: 114,914,859 V31M possibly damaging Het
Itgav A G 2: 83,802,036 E956G probably damaging Het
Lsm8 A G 6: 18,853,645 D86G probably damaging Het
Mdh1b T G 1: 63,715,239 H390P possibly damaging Het
Mtrf1l A T 10: 5,817,468 I216N possibly damaging Het
Muc16 G A 9: 18,654,926 T2099I unknown Het
Myh7 T C 14: 54,983,692 R925G probably damaging Het
Myo1h T A 5: 114,351,708 I658N probably damaging Het
Myo5a A T 9: 75,189,913 D81V possibly damaging Het
Nell1 G A 7: 49,975,423 C12Y possibly damaging Het
Obscn T C 11: 59,053,696 Y4724C probably damaging Het
Olfr1055 A G 2: 86,347,548 Y73H probably damaging Het
Pah G A 10: 87,576,187 D315N probably damaging Het
Per2 A G 1: 91,448,722 V143A probably damaging Het
Plcxd1 T C 5: 110,100,299 V38A probably benign Het
Pld1 A G 3: 28,130,747 probably benign Het
Plekhh2 A G 17: 84,575,787 N761S probably benign Het
Polh T C 17: 46,182,738 I318V probably benign Het
Prex1 T C 2: 166,572,960 Q1323R probably null Het
Rb1cc1 T A 1: 6,263,257 S1440T probably benign Het
Rbm19 G T 5: 120,127,040 W382L possibly damaging Het
Rchy1 T C 5: 91,957,942 D49G probably benign Het
Ric1 A G 19: 29,604,085 D1402G probably benign Het
S1pr3 G T 13: 51,419,031 A83S probably damaging Het
S1pr3 C A 13: 51,419,032 A83D probably damaging Het
Selplg G A 5: 113,820,149 P32L probably benign Het
Serpinb9c T C 13: 33,149,995 R355G probably damaging Het
Slx4 G C 16: 3,990,850 Q409E probably benign Het
Sntg1 A C 1: 8,583,284 L243R possibly damaging Het
Specc1l G T 10: 75,248,488 D682Y probably damaging Het
Spen C T 4: 141,471,633 V3228I possibly damaging Het
Strip1 T C 3: 107,628,200 E69G probably damaging Het
Tasp1 C A 2: 139,951,537 V240L probably damaging Het
Tdrd9 T A 12: 112,034,608 F787L probably damaging Het
Vmn1r228 A G 17: 20,776,882 S125P probably damaging Het
Wdhd1 A G 14: 47,251,922 M718T probably damaging Het
Other mutations in Gfm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Gfm2 APN 13 97155442 missense probably benign 0.38
IGL00781:Gfm2 APN 13 97149339 missense probably damaging 1.00
IGL00789:Gfm2 APN 13 97173058 unclassified probably benign
IGL00978:Gfm2 APN 13 97162977 missense probably benign 0.20
IGL01637:Gfm2 APN 13 97150409 missense probably damaging 1.00
IGL02318:Gfm2 APN 13 97162975 missense probably damaging 1.00
R0825:Gfm2 UTSW 13 97143104 splice site probably benign
R1173:Gfm2 UTSW 13 97165200 splice site probably null
R1847:Gfm2 UTSW 13 97162934 missense probably benign 0.04
R1932:Gfm2 UTSW 13 97141967 missense probably damaging 0.96
R2104:Gfm2 UTSW 13 97171520 missense probably damaging 0.99
R2108:Gfm2 UTSW 13 97155442 missense probably benign 0.38
R2877:Gfm2 UTSW 13 97153249 missense possibly damaging 0.80
R2878:Gfm2 UTSW 13 97153249 missense possibly damaging 0.80
R2898:Gfm2 UTSW 13 97172961 missense possibly damaging 0.85
R3931:Gfm2 UTSW 13 97175024 missense probably benign 0.02
R4011:Gfm2 UTSW 13 97143100 splice site probably benign
R4831:Gfm2 UTSW 13 97165038 missense probably damaging 1.00
R4921:Gfm2 UTSW 13 97175676 missense probably damaging 0.99
R5182:Gfm2 UTSW 13 97162893 missense probably damaging 1.00
R5309:Gfm2 UTSW 13 97163151 missense probably damaging 1.00
R5310:Gfm2 UTSW 13 97163151 missense probably damaging 1.00
R5311:Gfm2 UTSW 13 97163151 missense probably damaging 1.00
R5339:Gfm2 UTSW 13 97175040 missense probably benign
R5594:Gfm2 UTSW 13 97165038 missense probably damaging 1.00
R5599:Gfm2 UTSW 13 97163151 missense probably damaging 1.00
R6014:Gfm2 UTSW 13 97151661 intron probably null
R6041:Gfm2 UTSW 13 97172623 missense probably benign 0.11
R6108:Gfm2 UTSW 13 97149422 missense possibly damaging 0.79
R6596:Gfm2 UTSW 13 97165149 missense probably damaging 1.00
R6937:Gfm2 UTSW 13 97163064 splice site probably null
R6958:Gfm2 UTSW 13 97146236 missense probably damaging 1.00
R6996:Gfm2 UTSW 13 97149360 missense probably damaging 1.00
R7291:Gfm2 UTSW 13 97175024 missense probably benign 0.02
R7365:Gfm2 UTSW 13 97143021 missense probably benign 0.06
R7456:Gfm2 UTSW 13 97145703 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGAAATGTTACATCCTGGGCC -3'
(R):5'- AGTCACTCACTTGTTTAAGCCC -3'

Sequencing Primer
(F):5'- ATGTTACATCCTGGGCCTGGATAAC -3'
(R):5'- GCAATGTTTCCAGCAGTCAG -3'
Posted On2018-04-27