Incidental Mutation 'R6345:Myh7'
ID514128
Institutional Source Beutler Lab
Gene Symbol Myh7
Ensembl Gene ENSMUSG00000053093
Gene Namemyosin, heavy polypeptide 7, cardiac muscle, beta
SynonymsMyhcb, Myhc-b, MyHC-I, B-MHC, MYH-beta/slow, beta-MHC
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.812) question?
Stock #R6345 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location54970684-54994626 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54983692 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 925 (R925G)
Ref Sequence ENSEMBL: ENSMUSP00000126840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102803] [ENSMUST00000168485]
Predicted Effect probably damaging
Transcript: ENSMUST00000102803
AA Change: R925G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099867
Gene: ENSMUSG00000053093
AA Change: R925G

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Myosin_N 34 73 3.8e-16 PFAM
MYSc 79 779 N/A SMART
IQ 780 802 2.5e-2 SMART
Pfam:Myosin_tail_1 843 1924 5.6e-168 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149852
Predicted Effect probably damaging
Transcript: ENSMUST00000168485
AA Change: R925G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126840
Gene: ENSMUSG00000053093
AA Change: R925G

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Myosin_N 34 75 1.6e-17 PFAM
MYSc 79 779 N/A SMART
IQ 780 802 2.5e-2 SMART
PDB:2FXO|D 838 963 6e-53 PDB
Pfam:Myosin_tail_1 1068 1926 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228715
Meta Mutation Damage Score 0.726 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Muscle myosin is a hexameric protein containing 2 heavy chain subunits, 2 alkali light chain subunits, and 2 regulatory light chain subunits. This gene encodes the beta (or slow) heavy chain subunit of cardiac myosin. It is expressed predominantly in normal human ventricle. It is also expressed in skeletal muscle tissues rich in slow-twitch type I muscle fibers. Changes in the relative abundance of this protein and the alpha (or fast) heavy subunit of cardiac myosin correlate with the contractile velocity of cardiac muscle. Its expression is also altered during thyroid hormone depletion and hemodynamic overloading. Mutations in this gene are associated with familial hypertrophic cardiomyopathy, myosin storage myopathy, dilated cardiomyopathy, and Laing early-onset distal myopathy. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T C 10: 87,226,051 I121T probably benign Het
4921524L21Rik T A 18: 6,626,399 M137K possibly damaging Het
Angpt4 C A 2: 151,929,434 N223K probably benign Het
Ankrd6 T C 4: 32,810,266 R437G probably damaging Het
Atp9a C T 2: 168,676,173 S264N probably damaging Het
AY358078 A C 14: 51,826,292 Y465S probably damaging Het
Bin3 G A 14: 70,137,227 R235Q probably benign Het
Bsn G A 9: 108,107,355 P3167S unknown Het
Camk2g G A 14: 20,737,375 R274C probably damaging Het
Ccdc61 A T 7: 18,909,989 probably null Het
Ccnjl A T 11: 43,585,338 T263S probably benign Het
Col17a1 G T 19: 47,653,379 P944T possibly damaging Het
Cyp2c39 A T 19: 39,513,171 probably null Het
Cyp2c39 G T 19: 39,513,172 probably null Het
Cyp4a32 T C 4: 115,602,363 V98A possibly damaging Het
D430042O09Rik C A 7: 125,752,987 D26E probably damaging Het
Dnah9 A G 11: 66,037,693 V2050A probably damaging Het
F5 A G 1: 164,191,951 N665S probably benign Het
Fbxl6 A T 15: 76,535,854 C520S probably damaging Het
Fscn2 C A 11: 120,362,027 H107N probably damaging Het
Gfm2 C T 13: 97,162,953 T367M probably damaging Het
Gle1 C G 2: 29,936,115 P69A probably benign Het
Gpr156 A T 16: 37,987,519 D176V probably damaging Het
Grip2 A G 6: 91,765,388 S895P possibly damaging Het
Hfm1 C T 5: 106,841,638 G1404D probably benign Het
Ifit1bl1 G A 19: 34,594,170 R296* probably null Het
Ighv1-39 C T 12: 114,914,859 V31M possibly damaging Het
Itgav A G 2: 83,802,036 E956G probably damaging Het
Lsm8 A G 6: 18,853,645 D86G probably damaging Het
Mdh1b T G 1: 63,715,239 H390P possibly damaging Het
Mtrf1l A T 10: 5,817,468 I216N possibly damaging Het
Muc16 G A 9: 18,654,926 T2099I unknown Het
Myo1h T A 5: 114,351,708 I658N probably damaging Het
Myo5a A T 9: 75,189,913 D81V possibly damaging Het
Nell1 G A 7: 49,975,423 C12Y possibly damaging Het
Obscn T C 11: 59,053,696 Y4724C probably damaging Het
Olfr1055 A G 2: 86,347,548 Y73H probably damaging Het
Pah G A 10: 87,576,187 D315N probably damaging Het
Per2 A G 1: 91,448,722 V143A probably damaging Het
Plcxd1 T C 5: 110,100,299 V38A probably benign Het
Pld1 A G 3: 28,130,747 probably benign Het
Plekhh2 A G 17: 84,575,787 N761S probably benign Het
Polh T C 17: 46,182,738 I318V probably benign Het
Prex1 T C 2: 166,572,960 Q1323R probably null Het
Rb1cc1 T A 1: 6,263,257 S1440T probably benign Het
Rbm19 G T 5: 120,127,040 W382L possibly damaging Het
Rchy1 T C 5: 91,957,942 D49G probably benign Het
Ric1 A G 19: 29,604,085 D1402G probably benign Het
S1pr3 G T 13: 51,419,031 A83S probably damaging Het
S1pr3 C A 13: 51,419,032 A83D probably damaging Het
Selplg G A 5: 113,820,149 P32L probably benign Het
Serpinb9c T C 13: 33,149,995 R355G probably damaging Het
Slx4 G C 16: 3,990,850 Q409E probably benign Het
Sntg1 A C 1: 8,583,284 L243R possibly damaging Het
Specc1l G T 10: 75,248,488 D682Y probably damaging Het
Spen C T 4: 141,471,633 V3228I possibly damaging Het
Strip1 T C 3: 107,628,200 E69G probably damaging Het
Tasp1 C A 2: 139,951,537 V240L probably damaging Het
Tdrd9 T A 12: 112,034,608 F787L probably damaging Het
Vmn1r228 A G 17: 20,776,882 S125P probably damaging Het
Wdhd1 A G 14: 47,251,922 M718T probably damaging Het
Other mutations in Myh7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Myh7 APN 14 54987388 missense probably damaging 1.00
IGL01025:Myh7 APN 14 54979537 missense probably damaging 1.00
IGL01092:Myh7 APN 14 54971632 missense possibly damaging 0.91
IGL01384:Myh7 APN 14 54971459 missense probably damaging 1.00
IGL01457:Myh7 APN 14 54988879 missense possibly damaging 0.66
IGL01671:Myh7 APN 14 54972924 missense probably damaging 1.00
IGL01923:Myh7 APN 14 54985459 critical splice donor site probably null
IGL02183:Myh7 APN 14 54974731 missense probably benign
IGL02379:Myh7 APN 14 54979468 missense probably damaging 1.00
IGL02884:Myh7 APN 14 54992819 missense probably benign 0.26
IGL02898:Myh7 APN 14 54983740 missense probably damaging 1.00
IGL03027:Myh7 APN 14 54983550 missense probably damaging 1.00
IGL03061:Myh7 APN 14 54991204 unclassified probably benign
IGL03145:Myh7 APN 14 54983345 missense probably damaging 1.00
IGL03250:Myh7 APN 14 54992247 missense probably damaging 1.00
IGL03394:Myh7 APN 14 54975361 missense probably damaging 1.00
R0019:Myh7 UTSW 14 54983734 missense possibly damaging 0.91
R0030:Myh7 UTSW 14 54991970 missense probably benign 0.00
R0183:Myh7 UTSW 14 54978876 missense probably benign 0.02
R0230:Myh7 UTSW 14 54973933 missense probably benign 0.03
R0295:Myh7 UTSW 14 54984821 splice site probably benign
R0423:Myh7 UTSW 14 54979189 missense probably benign 0.06
R0537:Myh7 UTSW 14 54990799 missense possibly damaging 0.81
R0541:Myh7 UTSW 14 54974701 missense probably benign
R0581:Myh7 UTSW 14 54985496 missense probably benign 0.02
R0786:Myh7 UTSW 14 54992873 start codon destroyed probably null
R0866:Myh7 UTSW 14 54973139 missense probably benign
R1068:Myh7 UTSW 14 54987319 missense possibly damaging 0.93
R1075:Myh7 UTSW 14 54987403 missense probably benign
R1124:Myh7 UTSW 14 54973870 missense possibly damaging 0.78
R1140:Myh7 UTSW 14 54972882 missense probably damaging 1.00
R1260:Myh7 UTSW 14 54988451 missense probably benign 0.00
R1653:Myh7 UTSW 14 54990789 missense probably benign 0.00
R1677:Myh7 UTSW 14 54987516 missense probably benign 0.17
R1760:Myh7 UTSW 14 54972713 missense probably damaging 1.00
R1838:Myh7 UTSW 14 54973180 missense possibly damaging 0.91
R1839:Myh7 UTSW 14 54973180 missense possibly damaging 0.91
R2483:Myh7 UTSW 14 54973381 missense probably damaging 0.99
R2566:Myh7 UTSW 14 54983242 missense probably damaging 1.00
R3623:Myh7 UTSW 14 54973381 missense probably damaging 0.99
R3916:Myh7 UTSW 14 54974046 missense probably damaging 0.97
R4236:Myh7 UTSW 14 54991118 missense probably benign 0.34
R4471:Myh7 UTSW 14 54991854 nonsense probably null
R4700:Myh7 UTSW 14 54988321 missense possibly damaging 0.85
R4805:Myh7 UTSW 14 54985133 missense probably benign 0.27
R4880:Myh7 UTSW 14 54978588 missense probably benign 0.18
R4975:Myh7 UTSW 14 54971671 missense probably damaging 1.00
R4982:Myh7 UTSW 14 54972767 missense probably damaging 0.98
R5004:Myh7 UTSW 14 54971683 missense probably damaging 0.99
R5107:Myh7 UTSW 14 54986424 intron probably benign
R5124:Myh7 UTSW 14 54985742 nonsense probably null
R5256:Myh7 UTSW 14 54979508 missense probably damaging 1.00
R5335:Myh7 UTSW 14 54986563 intron probably benign
R5581:Myh7 UTSW 14 54978954 missense probably benign 0.00
R5861:Myh7 UTSW 14 54988890 missense possibly damaging 0.89
R5957:Myh7 UTSW 14 54989078 missense probably damaging 1.00
R6027:Myh7 UTSW 14 54970802 missense probably benign 0.01
R6184:Myh7 UTSW 14 54988858 missense probably damaging 1.00
R6232:Myh7 UTSW 14 54989296 missense probably benign 0.00
R6268:Myh7 UTSW 14 54989284 missense probably benign 0.00
R6274:Myh7 UTSW 14 54979486 missense probably damaging 0.97
R6383:Myh7 UTSW 14 54988894 missense probably benign 0.00
R6641:Myh7 UTSW 14 54982280 missense probably benign 0.37
R6755:Myh7 UTSW 14 54992313 missense possibly damaging 0.71
R6952:Myh7 UTSW 14 54991740 missense probably damaging 1.00
R7025:Myh7 UTSW 14 54974644 nonsense probably null
R7201:Myh7 UTSW 14 54990945 missense possibly damaging 0.58
R7257:Myh7 UTSW 14 54972490 intron probably null
R7296:Myh7 UTSW 14 54990025 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GGAACATGCTGTGGTTTGGAAC -3'
(R):5'- TGTGAAGACTTTGAGTTCCCTCC -3'

Sequencing Primer
(F):5'- GTTTGGAACCCGAGGGAAC -3'
(R):5'- AGAAGAAGCCAGGGTCCCTC -3'
Posted On2018-04-27