Incidental Mutation 'R6345:Polh'
ID514134
Institutional Source Beutler Lab
Gene Symbol Polh
Ensembl Gene ENSMUSG00000023953
Gene Namepolymerase (DNA directed), eta (RAD 30 related)
SynonymsRAD30A
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.438) question?
Stock #R6345 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location46172004-46202625 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46182738 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 318 (I318V)
Ref Sequence ENSEMBL: ENSMUSP00000024749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024749]
Predicted Effect probably benign
Transcript: ENSMUST00000024749
AA Change: I318V

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000024749
Gene: ENSMUSG00000023953
AA Change: I318V

DomainStartEndE-ValueType
Pfam:IMS 12 227 9.7e-53 PFAM
Pfam:IMS_C 308 435 5.8e-15 PFAM
low complexity region 515 529 N/A INTRINSIC
low complexity region 540 561 N/A INTRINSIC
PDB:2I5O|A 606 643 7e-15 PDB
Meta Mutation Damage Score 0.12 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Y family of specialized DNA polymerases. It copies undamaged DNA with a lower fidelity than other DNA-directed polymerases. However, it accurately replicates UV-damaged DNA; when thymine dimers are present, this polymerase inserts the complementary nucleotides in the newly synthesized DNA, thereby bypassing the lesion and suppressing the mutagenic effect of UV-induced DNA damage. This polymerase is thought to be involved in hypermutation during immunoglobulin class switch recombination. Mutations in this gene result in XPV, a variant type of xeroderma pigmentosum. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous inactivation of this gene causes increased susceptibility to UV-induced skin tumors and results in reduced immunoglobulin gene mutations at A-T base pairs with a G-C biased mutation pattern. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T C 10: 87,226,051 I121T probably benign Het
4921524L21Rik T A 18: 6,626,399 M137K possibly damaging Het
Angpt4 C A 2: 151,929,434 N223K probably benign Het
Ankrd6 T C 4: 32,810,266 R437G probably damaging Het
Atp9a C T 2: 168,676,173 S264N probably damaging Het
AY358078 A C 14: 51,826,292 Y465S probably damaging Het
Bin3 G A 14: 70,137,227 R235Q probably benign Het
Bsn G A 9: 108,107,355 P3167S unknown Het
Camk2g G A 14: 20,737,375 R274C probably damaging Het
Ccdc61 A T 7: 18,909,989 probably null Het
Ccnjl A T 11: 43,585,338 T263S probably benign Het
Col17a1 G T 19: 47,653,379 P944T possibly damaging Het
Cyp2c39 A T 19: 39,513,171 probably null Het
Cyp2c39 G T 19: 39,513,172 probably null Het
Cyp4a32 T C 4: 115,602,363 V98A possibly damaging Het
D430042O09Rik C A 7: 125,752,987 D26E probably damaging Het
Dnah9 A G 11: 66,037,693 V2050A probably damaging Het
F5 A G 1: 164,191,951 N665S probably benign Het
Fbxl6 A T 15: 76,535,854 C520S probably damaging Het
Fscn2 C A 11: 120,362,027 H107N probably damaging Het
Gfm2 C T 13: 97,162,953 T367M probably damaging Het
Gle1 C G 2: 29,936,115 P69A probably benign Het
Gpr156 A T 16: 37,987,519 D176V probably damaging Het
Grip2 A G 6: 91,765,388 S895P possibly damaging Het
Hfm1 C T 5: 106,841,638 G1404D probably benign Het
Ifit1bl1 G A 19: 34,594,170 R296* probably null Het
Ighv1-39 C T 12: 114,914,859 V31M possibly damaging Het
Itgav A G 2: 83,802,036 E956G probably damaging Het
Lsm8 A G 6: 18,853,645 D86G probably damaging Het
Mdh1b T G 1: 63,715,239 H390P possibly damaging Het
Mtrf1l A T 10: 5,817,468 I216N possibly damaging Het
Muc16 G A 9: 18,654,926 T2099I unknown Het
Myh7 T C 14: 54,983,692 R925G probably damaging Het
Myo1h T A 5: 114,351,708 I658N probably damaging Het
Myo5a A T 9: 75,189,913 D81V possibly damaging Het
Nell1 G A 7: 49,975,423 C12Y possibly damaging Het
Obscn T C 11: 59,053,696 Y4724C probably damaging Het
Olfr1055 A G 2: 86,347,548 Y73H probably damaging Het
Pah G A 10: 87,576,187 D315N probably damaging Het
Per2 A G 1: 91,448,722 V143A probably damaging Het
Plcxd1 T C 5: 110,100,299 V38A probably benign Het
Pld1 A G 3: 28,130,747 probably benign Het
Plekhh2 A G 17: 84,575,787 N761S probably benign Het
Prex1 T C 2: 166,572,960 Q1323R probably null Het
Rb1cc1 T A 1: 6,263,257 S1440T probably benign Het
Rbm19 G T 5: 120,127,040 W382L possibly damaging Het
Rchy1 T C 5: 91,957,942 D49G probably benign Het
Ric1 A G 19: 29,604,085 D1402G probably benign Het
S1pr3 G T 13: 51,419,031 A83S probably damaging Het
S1pr3 C A 13: 51,419,032 A83D probably damaging Het
Selplg G A 5: 113,820,149 P32L probably benign Het
Serpinb9c T C 13: 33,149,995 R355G probably damaging Het
Slx4 G C 16: 3,990,850 Q409E probably benign Het
Sntg1 A C 1: 8,583,284 L243R possibly damaging Het
Specc1l G T 10: 75,248,488 D682Y probably damaging Het
Spen C T 4: 141,471,633 V3228I possibly damaging Het
Strip1 T C 3: 107,628,200 E69G probably damaging Het
Tasp1 C A 2: 139,951,537 V240L probably damaging Het
Tdrd9 T A 12: 112,034,608 F787L probably damaging Het
Vmn1r228 A G 17: 20,776,882 S125P probably damaging Het
Wdhd1 A G 14: 47,251,922 M718T probably damaging Het
Other mutations in Polh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Polh APN 17 46172243 unclassified probably benign
IGL00585:Polh APN 17 46172243 unclassified probably benign
IGL01812:Polh APN 17 46172911 missense probably benign 0.04
IGL01996:Polh APN 17 46173001 missense probably benign 0.00
IGL02578:Polh APN 17 46194292 nonsense probably null
IGL02829:Polh APN 17 46172902 missense possibly damaging 0.82
IGL03003:Polh APN 17 46194366 missense possibly damaging 0.57
R1435:Polh UTSW 17 46194255 missense probably damaging 1.00
R2091:Polh UTSW 17 46181454 splice site probably benign
R2129:Polh UTSW 17 46188088 nonsense probably null
R4226:Polh UTSW 17 46172594 missense probably benign
R4227:Polh UTSW 17 46172594 missense probably benign
R5483:Polh UTSW 17 46172745 missense probably benign 0.01
R5878:Polh UTSW 17 46194325 missense probably damaging 0.99
R6039:Polh UTSW 17 46188033 missense probably benign 0.00
R6039:Polh UTSW 17 46188033 missense probably benign 0.00
R6177:Polh UTSW 17 46184744 missense possibly damaging 0.94
R6545:Polh UTSW 17 46182759 missense possibly damaging 0.74
R6712:Polh UTSW 17 46190729 missense probably benign 0.12
R7054:Polh UTSW 17 46198716 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- TGCAGCCAGTCCTATTTTACAC -3'
(R):5'- AGGATCACAATTAGAGGCCAGTTG -3'

Sequencing Primer
(F):5'- AGTCTGATGACAGCTCCAGTGTAC -3'
(R):5'- TGAATGAACGGTGAGACCTTCTC -3'
Posted On2018-04-27