Incidental Mutation 'R6350:Cdk5r1'
ID514160
Institutional Source Beutler Lab
Gene Symbol Cdk5r1
Ensembl Gene ENSMUSG00000048895
Gene Namecyclin-dependent kinase 5, regulatory subunit 1 (p35)
SynonymsD11Bwg0379e, p35, p25
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.643) question?
Stock #R6350 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location80477023-80481184 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80478242 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 245 (L245P)
Ref Sequence ENSEMBL: ENSMUSP00000099514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017572] [ENSMUST00000041065] [ENSMUST00000053413] [ENSMUST00000147694]
Predicted Effect probably benign
Transcript: ENSMUST00000017572
SMART Domains Protein: ENSMUSP00000017572
Gene: ENSMUSG00000017428

DomainStartEndE-ValueType
PAM 143 320 1.6e-67 SMART
PINT 321 404 4.34e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000041065
SMART Domains Protein: ENSMUSP00000037819
Gene: ENSMUSG00000035441

DomainStartEndE-ValueType
MYSc 3 696 N/A SMART
IQ 697 719 1.46e-3 SMART
Pfam:Myosin_TH1 803 1006 4.1e-49 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000053413
AA Change: L245P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099514
Gene: ENSMUSG00000048895
AA Change: L245P

DomainStartEndE-ValueType
Pfam:CDK5_activator 69 294 1.6e-100 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147694
SMART Domains Protein: ENSMUSP00000120964
Gene: ENSMUSG00000048895

DomainStartEndE-ValueType
Pfam:CDK5_activator 1 138 2.3e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173797
SMART Domains Protein: ENSMUSP00000133739
Gene: ENSMUSG00000017428

DomainStartEndE-ValueType
Blast:PAM 2 58 9e-33 BLAST
PINT 59 142 4.34e-23 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene (p35) is a neuron-specific activator of cyclin-dependent kinase 5 (CDK5); the activation of CDK5 is required for proper development of the central nervous system. The p35 form of this protein is proteolytically cleaved by calpain, generating a p25 form. The cleavage of p35 into p25 results in relocalization of the protein from the cell periphery to nuclear and perinuclear regions. P25 deregulates CDK5 activity by prolonging its activation and changing its cellular location. The p25 form accumulates in the brain neurons of patients with Alzheimer's disease. This accumulation correlates with an increase in CDK5 kinase activity, and may lead to aberrantly phosphorylated forms of the microtubule-associated protein tau, which contributes to Alzheimer's disease. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of the gene results in structural abnormalities of the brain such as a small corpus callosum and delaminated cerebral cortex. Mice show hyperactivity and decreased locomotion in response to stimulants. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 82,063,563 K554E possibly damaging Het
Acsf2 T C 11: 94,558,330 M609V probably benign Het
Acsm3 A G 7: 119,768,033 T30A probably benign Het
Adam32 T C 8: 24,863,429 K715E possibly damaging Het
Cntn3 A G 6: 102,170,618 V926A probably damaging Het
Csf2rb G A 15: 78,345,552 D440N probably damaging Het
D3Ertd751e T A 3: 41,753,843 H138Q probably damaging Het
D630003M21Rik A G 2: 158,220,495 L35P probably damaging Het
Faap100 A T 11: 120,374,580 V490E probably damaging Het
Il3ra A G 14: 14,348,903 D99G probably benign Het
Kcnmb1 A G 11: 33,964,711 K4R probably damaging Het
Larp1 T A 11: 58,049,831 D594E probably benign Het
Lnpep G T 17: 17,562,809 H577N probably benign Het
Mief1 T C 15: 80,249,603 I287T probably damaging Het
Mras T C 9: 99,411,507 S27G probably damaging Het
Myh7b T A 2: 155,628,760 C1043S probably benign Het
N4bp1 T C 8: 86,861,968 D114G probably damaging Het
Nsmce4a A T 7: 130,539,099 I219K probably damaging Het
Nynrin A T 14: 55,868,076 I848F probably benign Het
Olfr1318 T A 2: 112,156,197 I82N probably damaging Het
Olfr1370 T C 13: 21,072,605 E232G probably benign Het
Patj T A 4: 98,405,618 S36T probably benign Het
Pcdhb15 G A 18: 37,475,361 V549M probably damaging Het
Prl2c5 T C 13: 13,183,046 probably null Het
Ptbp3 A T 4: 59,482,624 D386E probably damaging Het
Ptpra T C 2: 130,540,592 L451P probably damaging Het
Repin1 A G 6: 48,597,628 D497G probably damaging Het
Ryr2 A G 13: 11,761,396 F1085S probably damaging Het
Slc6a18 G A 13: 73,677,925 A2V possibly damaging Het
Wee2 C T 6: 40,455,105 R203C probably damaging Het
Zmynd15 T C 11: 70,464,431 V388A probably damaging Het
Other mutations in Cdk5r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02450:Cdk5r1 APN 11 80477840 missense probably benign 0.09
IGL02754:Cdk5r1 APN 11 80477743 missense probably benign 0.00
R0230:Cdk5r1 UTSW 11 80477750 missense probably damaging 1.00
R4166:Cdk5r1 UTSW 11 80478209 missense probably damaging 1.00
R5537:Cdk5r1 UTSW 11 80477999 missense probably damaging 1.00
R5926:Cdk5r1 UTSW 11 80478302 unclassified probably null
R6841:Cdk5r1 UTSW 11 80478195 nonsense probably null
T0722:Cdk5r1 UTSW 11 80477881 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- TACCGCCTGAAGCACTTGTC -3'
(R):5'- AGGAGGAGTCGCTTCTTGTC -3'

Sequencing Primer
(F):5'- TGAAGCACTTGTCCCCAACG -3'
(R):5'- GGAGTCGCTTCTTGTCCTCCTG -3'
Posted On2018-04-27