Incidental Mutation 'R6350:Faap100'
ID514162
Institutional Source Beutler Lab
Gene Symbol Faap100
Ensembl Gene ENSMUSG00000025384
Gene NameFanconi anemia core complex associated protein 100
Synonyms2310003H01Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.267) question?
Stock #R6350 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location120369055-120378764 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 120374580 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 490 (V490E)
Ref Sequence ENSEMBL: ENSMUSP00000026448 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026448]
Predicted Effect probably damaging
Transcript: ENSMUST00000026448
AA Change: V490E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026448
Gene: ENSMUSG00000025384
AA Change: V490E

DomainStartEndE-ValueType
Pfam:FANCAA 447 879 1.4e-196 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129203
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134771
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135635
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148520
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152346
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153015
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154826
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] FAAP100 is a component of the Fanconi anemia (FA; MIM 277650) core complex and is required for core complex stability and FANCD2 (see MIM 227646) monoubiquitination (Ling et al., 2007 [PubMed 17396147]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 82,063,563 K554E possibly damaging Het
Acsf2 T C 11: 94,558,330 M609V probably benign Het
Acsm3 A G 7: 119,768,033 T30A probably benign Het
Adam32 T C 8: 24,863,429 K715E possibly damaging Het
Cdk5r1 T C 11: 80,478,242 L245P probably damaging Het
Cntn3 A G 6: 102,170,618 V926A probably damaging Het
Csf2rb G A 15: 78,345,552 D440N probably damaging Het
D3Ertd751e T A 3: 41,753,843 H138Q probably damaging Het
D630003M21Rik A G 2: 158,220,495 L35P probably damaging Het
Il3ra A G 14: 14,348,903 D99G probably benign Het
Kcnmb1 A G 11: 33,964,711 K4R probably damaging Het
Larp1 T A 11: 58,049,831 D594E probably benign Het
Lnpep G T 17: 17,562,809 H577N probably benign Het
Mief1 T C 15: 80,249,603 I287T probably damaging Het
Mras T C 9: 99,411,507 S27G probably damaging Het
Myh7b T A 2: 155,628,760 C1043S probably benign Het
N4bp1 T C 8: 86,861,968 D114G probably damaging Het
Nsmce4a A T 7: 130,539,099 I219K probably damaging Het
Nynrin A T 14: 55,868,076 I848F probably benign Het
Olfr1318 T A 2: 112,156,197 I82N probably damaging Het
Olfr1370 T C 13: 21,072,605 E232G probably benign Het
Patj T A 4: 98,405,618 S36T probably benign Het
Pcdhb15 G A 18: 37,475,361 V549M probably damaging Het
Prl2c5 T C 13: 13,183,046 probably null Het
Ptbp3 A T 4: 59,482,624 D386E probably damaging Het
Ptpra T C 2: 130,540,592 L451P probably damaging Het
Repin1 A G 6: 48,597,628 D497G probably damaging Het
Ryr2 A G 13: 11,761,396 F1085S probably damaging Het
Slc6a18 G A 13: 73,677,925 A2V possibly damaging Het
Wee2 C T 6: 40,455,105 R203C probably damaging Het
Zmynd15 T C 11: 70,464,431 V388A probably damaging Het
Other mutations in Faap100
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Faap100 APN 11 120372132 missense probably damaging 1.00
IGL02954:Faap100 APN 11 120372131 missense probably damaging 1.00
IGL02799:Faap100 UTSW 11 120370735 missense probably damaging 1.00
R0034:Faap100 UTSW 11 120372147 missense probably benign 0.34
R0207:Faap100 UTSW 11 120374365 missense probably damaging 1.00
R0432:Faap100 UTSW 11 120373876 splice site probably benign
R0570:Faap100 UTSW 11 120374288 missense possibly damaging 0.87
R0748:Faap100 UTSW 11 120372171 missense probably damaging 0.97
R0782:Faap100 UTSW 11 120376704 critical splice donor site probably null
R1218:Faap100 UTSW 11 120378340 missense probably benign 0.06
R1612:Faap100 UTSW 11 120377088 missense probably damaging 1.00
R1720:Faap100 UTSW 11 120374581 missense probably damaging 1.00
R1758:Faap100 UTSW 11 120377233 missense probably damaging 0.99
R2881:Faap100 UTSW 11 120374359 missense probably damaging 1.00
R2893:Faap100 UTSW 11 120374625 missense probably damaging 1.00
R3969:Faap100 UTSW 11 120378705 start codon destroyed probably null 1.00
R4824:Faap100 UTSW 11 120375586 unclassified probably null
R4911:Faap100 UTSW 11 120372113 missense probably benign 0.37
R5152:Faap100 UTSW 11 120377632 missense possibly damaging 0.71
R5155:Faap100 UTSW 11 120377632 missense possibly damaging 0.71
R5327:Faap100 UTSW 11 120377632 missense possibly damaging 0.71
R5328:Faap100 UTSW 11 120377632 missense possibly damaging 0.71
R5386:Faap100 UTSW 11 120377632 missense possibly damaging 0.71
R5480:Faap100 UTSW 11 120377113 missense probably damaging 1.00
R5541:Faap100 UTSW 11 120377632 missense possibly damaging 0.71
R5629:Faap100 UTSW 11 120377011 missense probably damaging 1.00
R5911:Faap100 UTSW 11 120377132 missense possibly damaging 0.94
R6285:Faap100 UTSW 11 120376732 missense probably damaging 1.00
R6525:Faap100 UTSW 11 120378764 unclassified probably null
R7046:Faap100 UTSW 11 120377374 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GTCAGCACCTGAATACACAAGG -3'
(R):5'- GGCAGAGAAAGATGTCCTCC -3'

Sequencing Primer
(F):5'- TGAATACACAAGGTCCAGCCCTG -3'
(R):5'- CAGAGAAAGATGTCCTCCTTCGG -3'
Posted On2018-04-27