Incidental Mutation 'R6350:Lnpep'
ID514172
Institutional Source Beutler Lab
Gene Symbol Lnpep
Ensembl Gene ENSMUSG00000023845
Gene Nameleucyl/cystinyl aminopeptidase
Synonymsgp160, 4732490P18Rik, 2010309L07Rik, IRAP, vp165
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6350 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location17521410-17625050 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 17562809 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 577 (H577N)
Ref Sequence ENSEMBL: ENSMUSP00000036998 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041047]
Predicted Effect probably benign
Transcript: ENSMUST00000041047
AA Change: H577N

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000036998
Gene: ENSMUSG00000023845
AA Change: H577N

DomainStartEndE-ValueType
low complexity region 60 71 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
Pfam:Peptidase_M1 167 552 9.2e-143 PFAM
Pfam:ERAP1_C 689 1007 1e-60 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231515
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232462
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232515
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc-dependent aminopeptidase that cleaves vasopressin, oxytocin, lys-bradykinin, met-enkephalin, dynorphin A and other peptide hormones. The protein can be secreted in maternal serum, reside in intracellular vesicles with the insulin-responsive glucose transporter GLUT4, or form a type II integral membrane glycoprotein. The protein catalyzes the final step in the conversion of angiotensinogen to angiotensin IV (AT4) and is also a receptor for AT4. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a somewhat reduced tissue uptake of glucose either basally or after insulin stimulation. Mice homozygous for a different knock-out allele exhibit impaired coordination at 3 months and impaired spatial working memory in a Y maze at 6 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 82,063,563 K554E possibly damaging Het
Acsf2 T C 11: 94,558,330 M609V probably benign Het
Acsm3 A G 7: 119,768,033 T30A probably benign Het
Adam32 T C 8: 24,863,429 K715E possibly damaging Het
Cdk5r1 T C 11: 80,478,242 L245P probably damaging Het
Cntn3 A G 6: 102,170,618 V926A probably damaging Het
Csf2rb G A 15: 78,345,552 D440N probably damaging Het
D3Ertd751e T A 3: 41,753,843 H138Q probably damaging Het
D630003M21Rik A G 2: 158,220,495 L35P probably damaging Het
Faap100 A T 11: 120,374,580 V490E probably damaging Het
Il3ra A G 14: 14,348,903 D99G probably benign Het
Kcnmb1 A G 11: 33,964,711 K4R probably damaging Het
Larp1 T A 11: 58,049,831 D594E probably benign Het
Mief1 T C 15: 80,249,603 I287T probably damaging Het
Mras T C 9: 99,411,507 S27G probably damaging Het
Myh7b T A 2: 155,628,760 C1043S probably benign Het
N4bp1 T C 8: 86,861,968 D114G probably damaging Het
Nsmce4a A T 7: 130,539,099 I219K probably damaging Het
Nynrin A T 14: 55,868,076 I848F probably benign Het
Olfr1318 T A 2: 112,156,197 I82N probably damaging Het
Olfr1370 T C 13: 21,072,605 E232G probably benign Het
Patj T A 4: 98,405,618 S36T probably benign Het
Pcdhb15 G A 18: 37,475,361 V549M probably damaging Het
Prl2c5 T C 13: 13,183,046 probably null Het
Ptbp3 A T 4: 59,482,624 D386E probably damaging Het
Ptpra T C 2: 130,540,592 L451P probably damaging Het
Repin1 A G 6: 48,597,628 D497G probably damaging Het
Ryr2 A G 13: 11,761,396 F1085S probably damaging Het
Slc6a18 G A 13: 73,677,925 A2V possibly damaging Het
Wee2 C T 6: 40,455,105 R203C probably damaging Het
Zmynd15 T C 11: 70,464,431 V388A probably damaging Het
Other mutations in Lnpep
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01983:Lnpep APN 17 17531178 missense probably damaging 1.00
IGL02008:Lnpep APN 17 17570957 missense probably benign 0.40
IGL02040:Lnpep APN 17 17544905 missense probably benign 0.13
IGL02392:Lnpep APN 17 17579183 missense possibly damaging 0.48
IGL02417:Lnpep APN 17 17544903 missense possibly damaging 0.57
IGL02659:Lnpep APN 17 17570900 missense possibly damaging 0.83
IGL02697:Lnpep APN 17 17553193 missense probably benign
IGL02947:Lnpep APN 17 17570972 missense probably damaging 1.00
IGL03493:Lnpep APN 17 17579171 missense probably damaging 1.00
I0000:Lnpep UTSW 17 17578971 missense probably damaging 1.00
PIT4504001:Lnpep UTSW 17 17579027 missense probably benign 0.00
R0528:Lnpep UTSW 17 17531132 splice site probably benign
R0535:Lnpep UTSW 17 17571673 missense possibly damaging 0.91
R0540:Lnpep UTSW 17 17538554 missense probably damaging 1.00
R0586:Lnpep UTSW 17 17575396 splice site probably benign
R0607:Lnpep UTSW 17 17538554 missense probably damaging 1.00
R1502:Lnpep UTSW 17 17571644 missense probably damaging 1.00
R1570:Lnpep UTSW 17 17579156 missense probably damaging 1.00
R1733:Lnpep UTSW 17 17553313 missense probably benign 0.00
R1826:Lnpep UTSW 17 17562836 missense probably damaging 1.00
R2015:Lnpep UTSW 17 17579063 missense probably damaging 0.99
R2029:Lnpep UTSW 17 17568399 missense probably damaging 1.00
R4593:Lnpep UTSW 17 17579027 missense probably benign 0.00
R4638:Lnpep UTSW 17 17575307 missense probably damaging 1.00
R4741:Lnpep UTSW 17 17571658 missense probably damaging 1.00
R4919:Lnpep UTSW 17 17578911 missense probably damaging 1.00
R5030:Lnpep UTSW 17 17579309 missense probably damaging 1.00
R5111:Lnpep UTSW 17 17578610 missense possibly damaging 0.93
R5203:Lnpep UTSW 17 17537063 missense probably damaging 1.00
R5320:Lnpep UTSW 17 17546465 missense possibly damaging 0.83
R5419:Lnpep UTSW 17 17566730 missense probably damaging 1.00
R5535:Lnpep UTSW 17 17538694 missense probably benign 0.02
R5680:Lnpep UTSW 17 17579182 nonsense probably null
R6134:Lnpep UTSW 17 17553192 missense probably benign
R6142:Lnpep UTSW 17 17566681 critical splice donor site probably null
R6189:Lnpep UTSW 17 17566739 missense possibly damaging 0.46
R6225:Lnpep UTSW 17 17578983 missense possibly damaging 0.66
R6357:Lnpep UTSW 17 17552914 missense probably benign 0.00
R6765:Lnpep UTSW 17 17530496 missense probably damaging 1.00
R6794:Lnpep UTSW 17 17531159 missense probably damaging 1.00
R7013:Lnpep UTSW 17 17568363 missense probably benign 0.04
R7208:Lnpep UTSW 17 17552910 nonsense probably null
R7268:Lnpep UTSW 17 17538541 missense probably benign
X0004:Lnpep UTSW 17 17544812 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TACAGAATAATATGACCATCCAGGG -3'
(R):5'- TGGTCTACATCTGTGTACATGGAAG -3'

Sequencing Primer
(F):5'- ACAAACAGTACTTTCACTTCTTGAC -3'
(R):5'- ACCATAACCATGTTGTATATGTGAAG -3'
Posted On2018-04-27