Incidental Mutation 'R6359:Nol8'
ID514199
Institutional Source Beutler Lab
Gene Symbol Nol8
Ensembl Gene ENSMUSG00000021392
Gene Namenucleolar protein 8
Synonyms5730412B09Rik, D13Ertd548e, 4921532D18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6359 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location49653078-49679016 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 49664070 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 774 (D774G)
Ref Sequence ENSEMBL: ENSMUSP00000152878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021824] [ENSMUST00000221083] [ENSMUST00000221142] [ENSMUST00000222197] [ENSMUST00000223467]
Predicted Effect probably benign
Transcript: ENSMUST00000021824
AA Change: D792G

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000021824
Gene: ENSMUSG00000021392
AA Change: D792G

DomainStartEndE-ValueType
RRM 27 103 3.02e-9 SMART
low complexity region 315 327 N/A INTRINSIC
low complexity region 454 468 N/A INTRINSIC
low complexity region 712 724 N/A INTRINSIC
low complexity region 804 816 N/A INTRINSIC
low complexity region 836 849 N/A INTRINSIC
coiled coil region 886 916 N/A INTRINSIC
coiled coil region 955 981 N/A INTRINSIC
low complexity region 1080 1093 N/A INTRINSIC
low complexity region 1152 1164 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000221083
Predicted Effect probably benign
Transcript: ENSMUST00000221142
AA Change: D774G

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000222197
AA Change: D792G

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223346
Predicted Effect probably benign
Transcript: ENSMUST00000223467
AA Change: D774G

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.03 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 100% (30/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NOL8 binds Ras-related GTP-binding proteins (see MIM 608267) and plays a role in cell growth (Sekiguchi et al., 2004 [PubMed 14660641]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asic5 A T 3: 82,004,496 D133V possibly damaging Het
Atp11b A G 3: 35,778,061 I22V probably benign Het
Ccdc18 C T 5: 108,135,525 T34I probably damaging Het
Ces2a A G 8: 104,736,078 I100V probably benign Het
Ddi2 T A 4: 141,684,588 T338S probably damaging Het
Dync1li1 A G 9: 114,713,570 I267V probably benign Het
Fbxo10 A T 4: 45,041,796 V637E possibly damaging Het
Gak T C 5: 108,571,900 E458G probably damaging Het
Glp1r G T 17: 30,929,972 V287F probably damaging Het
Gm2035 G A 12: 87,919,505 T118M probably benign Het
Gsdmc2 T C 15: 63,825,017 E435G probably damaging Het
Hsd11b1 T A 1: 193,242,352 probably benign Het
Igkv13-84 T G 6: 68,939,608 F3V probably benign Het
Igsf9b C A 9: 27,309,599 A87E probably benign Het
Ints1 G T 5: 139,756,217 L1796I probably benign Het
Ipo8 A G 6: 148,777,250 L950P probably benign Het
Lama5 T C 2: 180,195,982 D931G probably benign Het
Lamb1 A G 12: 31,282,716 E327G probably damaging Het
Lrp1b T C 2: 41,295,596 Y1369C probably damaging Het
Mapk3 A G 7: 126,760,756 T67A probably benign Het
Mrpl4 T A 9: 21,007,734 V225E probably damaging Het
Ncln C T 10: 81,490,284 G278S probably damaging Het
Nlrp3 G A 11: 59,548,566 R323Q probably damaging Het
Olfr266 A T 3: 106,822,415 I48N probably damaging Het
Olfr656 T C 7: 104,618,303 V208A probably damaging Het
Plekha8 G T 6: 54,613,119 C23F probably damaging Het
Prkag1 T C 15: 98,814,552 Y133C probably damaging Het
Spata31d1a A G 13: 59,703,106 S403P probably benign Het
Spata31d1c A T 13: 65,035,592 N316I possibly damaging Het
Tmem30c A T 16: 57,276,150 S203T probably benign Het
Ttn T G 2: 76,738,956 N18871H possibly damaging Het
Other mutations in Nol8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Nol8 APN 13 49662228 missense probably benign 0.01
IGL01106:Nol8 APN 13 49654481 missense possibly damaging 0.46
IGL01413:Nol8 APN 13 49659952 missense possibly damaging 0.82
IGL01540:Nol8 APN 13 49661670 missense probably benign 0.06
IGL01670:Nol8 APN 13 49661308 missense possibly damaging 0.54
IGL01672:Nol8 APN 13 49675407 missense possibly damaging 0.95
IGL02032:Nol8 APN 13 49672772 missense probably benign
IGL02212:Nol8 APN 13 49662150 missense possibly damaging 0.87
IGL02323:Nol8 APN 13 49655245 splice site probably benign
IGL02645:Nol8 APN 13 49665471 critical splice donor site probably null
IGL02949:Nol8 APN 13 49662402 missense probably benign 0.01
IGL02954:Nol8 APN 13 49661172 missense probably benign 0.01
IGL03182:Nol8 APN 13 49664081 missense probably damaging 1.00
IGL03406:Nol8 APN 13 49661568 missense probably damaging 1.00
P0047:Nol8 UTSW 13 49654348 splice site probably null
R0092:Nol8 UTSW 13 49662447 missense possibly damaging 0.54
R0099:Nol8 UTSW 13 49672689 missense probably benign
R0145:Nol8 UTSW 13 49662447 missense possibly damaging 0.54
R0269:Nol8 UTSW 13 49654445 missense possibly damaging 0.49
R0370:Nol8 UTSW 13 49662447 missense possibly damaging 0.54
R0374:Nol8 UTSW 13 49662447 missense possibly damaging 0.54
R0390:Nol8 UTSW 13 49662152 missense probably damaging 1.00
R0617:Nol8 UTSW 13 49654445 missense possibly damaging 0.49
R0635:Nol8 UTSW 13 49676758 missense probably benign 0.05
R0637:Nol8 UTSW 13 49662447 missense possibly damaging 0.54
R1246:Nol8 UTSW 13 49676769 missense probably damaging 1.00
R1446:Nol8 UTSW 13 49655227 missense probably damaging 1.00
R1464:Nol8 UTSW 13 49676788 missense probably benign
R1464:Nol8 UTSW 13 49676788 missense probably benign
R1627:Nol8 UTSW 13 49661504 missense probably benign 0.01
R1703:Nol8 UTSW 13 49667457 missense possibly damaging 0.65
R1751:Nol8 UTSW 13 49667408 missense probably benign 0.06
R2187:Nol8 UTSW 13 49661999 missense probably benign 0.00
R2357:Nol8 UTSW 13 49654504 critical splice donor site probably null
R3081:Nol8 UTSW 13 49678392 unclassified probably benign
R3969:Nol8 UTSW 13 49660016 nonsense probably null
R4199:Nol8 UTSW 13 49661748 missense possibly damaging 0.65
R4720:Nol8 UTSW 13 49662753 missense probably damaging 1.00
R4927:Nol8 UTSW 13 49654425 missense possibly damaging 0.79
R5177:Nol8 UTSW 13 49661112 missense probably benign 0.32
R5512:Nol8 UTSW 13 49676787 missense probably benign
R5744:Nol8 UTSW 13 49662326 missense possibly damaging 0.82
R5988:Nol8 UTSW 13 49672614 missense possibly damaging 0.58
R6048:Nol8 UTSW 13 49653684 critical splice donor site probably null
R6306:Nol8 UTSW 13 49676353 missense probably damaging 1.00
R6378:Nol8 UTSW 13 49667355 missense probably damaging 1.00
R6655:Nol8 UTSW 13 49654392 missense probably damaging 1.00
R7035:Nol8 UTSW 13 49661202 missense probably benign 0.06
R7058:Nol8 UTSW 13 49676386 missense probably damaging 1.00
R7368:Nol8 UTSW 13 49661219 missense probably benign 0.00
R7450:Nol8 UTSW 13 49660015 missense probably benign 0.01
X0020:Nol8 UTSW 13 49661165 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTGAGGTCAAGTTGATTGTTACTG -3'
(R):5'- AAGTTTAAAGGCAGCCTGGG -3'

Sequencing Primer
(F):5'- AGGTCAAGTTGATTGTTACTGGATAC -3'
(R):5'- GGCCTTACTTTCATCAGC -3'
Posted On2018-04-27