Incidental Mutation 'R6359:Gsdmc2'
ID514202
Institutional Source Beutler Lab
Gene Symbol Gsdmc2
Ensembl Gene ENSMUSG00000056293
Gene Namegasdermin C2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R6359 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location63824346-63845177 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 63825017 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 435 (E435G)
Ref Sequence ENSEMBL: ENSMUSP00000140487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089900] [ENSMUST00000188404] [ENSMUST00000188691]
Predicted Effect probably damaging
Transcript: ENSMUST00000089900
AA Change: E435G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000087344
Gene: ENSMUSG00000056293
AA Change: E435G

DomainStartEndE-ValueType
Pfam:Gasdermin 4 443 1.8e-157 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185277
Predicted Effect probably damaging
Transcript: ENSMUST00000188404
AA Change: E435G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141066
Gene: ENSMUSG00000056293
AA Change: E435G

DomainStartEndE-ValueType
Pfam:Gasdermin 4 443 1.7e-148 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000188691
AA Change: E435G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140487
Gene: ENSMUSG00000056293
AA Change: E435G

DomainStartEndE-ValueType
Pfam:Gasdermin 4 443 1.7e-148 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 100% (30/30)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asic5 A T 3: 82,004,496 D133V possibly damaging Het
Atp11b A G 3: 35,778,061 I22V probably benign Het
Ccdc18 C T 5: 108,135,525 T34I probably damaging Het
Ces2a A G 8: 104,736,078 I100V probably benign Het
Ddi2 T A 4: 141,684,588 T338S probably damaging Het
Dync1li1 A G 9: 114,713,570 I267V probably benign Het
Fbxo10 A T 4: 45,041,796 V637E possibly damaging Het
Gak T C 5: 108,571,900 E458G probably damaging Het
Glp1r G T 17: 30,929,972 V287F probably damaging Het
Gm2035 G A 12: 87,919,505 T118M probably benign Het
Hsd11b1 T A 1: 193,242,352 probably benign Het
Igkv13-84 T G 6: 68,939,608 F3V probably benign Het
Igsf9b C A 9: 27,309,599 A87E probably benign Het
Ints1 G T 5: 139,756,217 L1796I probably benign Het
Ipo8 A G 6: 148,777,250 L950P probably benign Het
Lama5 T C 2: 180,195,982 D931G probably benign Het
Lamb1 A G 12: 31,282,716 E327G probably damaging Het
Lrp1b T C 2: 41,295,596 Y1369C probably damaging Het
Mapk3 A G 7: 126,760,756 T67A probably benign Het
Mrpl4 T A 9: 21,007,734 V225E probably damaging Het
Ncln C T 10: 81,490,284 G278S probably damaging Het
Nlrp3 G A 11: 59,548,566 R323Q probably damaging Het
Nol8 A G 13: 49,664,070 D774G probably benign Het
Olfr266 A T 3: 106,822,415 I48N probably damaging Het
Olfr656 T C 7: 104,618,303 V208A probably damaging Het
Plekha8 G T 6: 54,613,119 C23F probably damaging Het
Prkag1 T C 15: 98,814,552 Y133C probably damaging Het
Spata31d1a A G 13: 59,703,106 S403P probably benign Het
Spata31d1c A T 13: 65,035,592 N316I possibly damaging Het
Tmem30c A T 16: 57,276,150 S203T probably benign Het
Ttn T G 2: 76,738,956 N18871H possibly damaging Het
Other mutations in Gsdmc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00556:Gsdmc2 APN 15 63828271 splice site probably benign
IGL02212:Gsdmc2 APN 15 63828062 splice site probably benign
IGL02394:Gsdmc2 APN 15 63835880 missense probably damaging 1.00
IGL02683:Gsdmc2 APN 15 63833412 missense probably damaging 1.00
R0046:Gsdmc2 UTSW 15 63827755 splice site probably benign
R0105:Gsdmc2 UTSW 15 63828177 missense probably benign
R0105:Gsdmc2 UTSW 15 63828177 missense probably benign
R0655:Gsdmc2 UTSW 15 63827773 missense probably benign 0.00
R1066:Gsdmc2 UTSW 15 63825050 missense possibly damaging 0.92
R1283:Gsdmc2 UTSW 15 63825057 missense probably damaging 0.99
R1691:Gsdmc2 UTSW 15 63833465 missense probably damaging 1.00
R1727:Gsdmc2 UTSW 15 63849779 unclassified probably benign
R1911:Gsdmc2 UTSW 15 63827772 missense probably benign 0.00
R1990:Gsdmc2 UTSW 15 63828237 missense probably benign 0.00
R1991:Gsdmc2 UTSW 15 63828237 missense probably benign 0.00
R2018:Gsdmc2 UTSW 15 63828126 intron probably null
R2090:Gsdmc2 UTSW 15 63826826 missense probably benign 0.09
R3037:Gsdmc2 UTSW 15 63833331 missense probably benign 0.00
R3964:Gsdmc2 UTSW 15 63849834 unclassified probably benign
R4308:Gsdmc2 UTSW 15 63848705 unclassified probably benign
R4574:Gsdmc2 UTSW 15 63828023 critical splice donor site probably null
R4738:Gsdmc2 UTSW 15 63826801 nonsense probably null
R4873:Gsdmc2 UTSW 15 63828252 missense probably benign 0.41
R4875:Gsdmc2 UTSW 15 63828252 missense probably benign 0.41
R4883:Gsdmc2 UTSW 15 63835765 missense probably damaging 1.00
R5115:Gsdmc2 UTSW 15 63827768 missense probably benign 0.00
R5241:Gsdmc2 UTSW 15 63824894 missense probably benign 0.00
R5510:Gsdmc2 UTSW 15 63828196 missense probably benign
R5841:Gsdmc2 UTSW 15 63826210 missense probably benign 0.00
R5987:Gsdmc2 UTSW 15 63830866 missense probably benign 0.00
R6199:Gsdmc2 UTSW 15 63825113 missense probably benign 0.01
R6610:Gsdmc2 UTSW 15 63825008 missense probably benign 0.03
R6984:Gsdmc2 UTSW 15 63825049 nonsense probably null
R7092:Gsdmc2 UTSW 15 63825098 missense probably damaging 0.99
R7204:Gsdmc2 UTSW 15 63825054 missense probably damaging 1.00
R7247:Gsdmc2 UTSW 15 63833334 missense probably benign 0.02
R7409:Gsdmc2 UTSW 15 63833346 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- GGCCTAAAACATGCATGGTG -3'
(R):5'- CAGGCCTTGCTCATTAGGTC -3'

Sequencing Primer
(F):5'- GCAATATATCAAATGTATCCAGGACG -3'
(R):5'- TGGGACAGATCTTACCCTGG -3'
Posted On2018-04-27