Incidental Mutation 'R6351:Ptprq'
ID514266
Institutional Source Beutler Lab
Gene Symbol Ptprq
Ensembl Gene ENSMUSG00000035916
Gene Nameprotein tyrosine phosphatase, receptor type, Q
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.390) question?
Stock #R6351 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location107517049-107720051 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 107708668 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 334 (T334S)
Ref Sequence ENSEMBL: ENSMUSP00000058572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050702]
Predicted Effect probably damaging
Transcript: ENSMUST00000050702
AA Change: T334S

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000058572
Gene: ENSMUSG00000035916
AA Change: T334S

DomainStartEndE-ValueType
FN3 57 141 3.17e-13 SMART
FN3 156 294 1.55e-7 SMART
FN3 307 384 4.45e-8 SMART
FN3 398 555 1.17e-7 SMART
FN3 569 648 7.06e-11 SMART
FN3 666 743 7.68e-12 SMART
FN3 760 839 1.88e-6 SMART
FN3 855 932 1.33e-6 SMART
FN3 949 1037 2.31e-6 SMART
FN3 1054 1135 1.24e-6 SMART
FN3 1151 1229 2.39e-8 SMART
FN3 1244 1325 6.29e-8 SMART
FN3 1341 1416 2.87e-11 SMART
FN3 1431 1524 2.82e-10 SMART
FN3 1540 1622 6.35e-4 SMART
FN3 1642 1732 7.93e-5 SMART
transmembrane domain 1907 1929 N/A INTRINSIC
PTPc 2003 2262 1.14e-130 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218399
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 99% (95/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a member of the type III receptor-like protein-tyrosine phosphatase family. The encoded protein catalyzes the dephosphorylation of phosphotyrosine and phosphatidylinositol and plays roles in cellular proliferation and differentiation. Mutations at this locus have been linked to autosomal recessive deafness. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygotes for targeted mutations show absence of shaft connectors from vestibular hair bundles, postnatal degeneration in cochlear hair-bundle structure, reduced transducer currents but otherwise normal adaptation properties, a progressive loss of basal-coil cochlear hair cells, and deafness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025F22Rik C T 19: 11,142,401 G14D probably damaging Het
4932438A13Rik G A 3: 36,908,228 A493T probably damaging Het
Acaa1a C A 9: 119,341,564 S17* probably null Het
Adamts16 T A 13: 70,836,203 S114C probably damaging Het
Agpat5 T C 8: 18,846,708 V50A probably benign Het
Agrn T C 4: 156,179,434 N124S probably benign Het
AI481877 T C 4: 59,069,317 D703G probably benign Het
Ak8 T C 2: 28,735,626 I227T probably benign Het
Akap6 A G 12: 53,142,025 E2074G probably damaging Het
Apc T A 18: 34,312,212 S702R probably damaging Het
Ascc3 T C 10: 50,720,673 I1233T probably damaging Het
Asphd2 A T 5: 112,385,832 F318I probably damaging Het
Bnc2 T C 4: 84,293,143 T397A probably benign Het
Bpifb4 C T 2: 153,957,134 T528I probably damaging Het
Brinp3 A G 1: 146,901,585 E590G probably damaging Het
Ccdc149 A G 5: 52,385,135 S372P probably benign Het
Cdhr2 A G 13: 54,726,776 H887R probably benign Het
Clcn6 C T 4: 148,017,500 V376I probably benign Het
Cntln T G 4: 85,115,354 C1305W probably damaging Het
Cspg4 A G 9: 56,892,644 D1564G probably benign Het
Cux1 A T 5: 136,309,792 S582T probably damaging Het
Cwh43 G A 5: 73,411,905 A97T possibly damaging Het
Dsc1 A T 18: 20,086,769 F781L probably damaging Het
Dsc3 G T 18: 19,966,291 H723N probably benign Het
Ear10 A T 14: 43,923,055 V105D probably damaging Het
Ecel1 A G 1: 87,149,509 V659A possibly damaging Het
Eogt A T 6: 97,120,194 F316I probably damaging Het
Etaa1 T C 11: 17,947,188 N310D possibly damaging Het
Exoc3l2 G A 7: 19,469,708 R75Q possibly damaging Het
Fam186a A C 15: 99,941,742 L2207R probably damaging Het
Fam187b T C 7: 30,977,599 Y178H probably damaging Het
Fat1 A T 8: 45,033,495 Q3362L probably damaging Het
Fat3 A T 9: 15,938,398 S3903T probably damaging Het
Fsip2 G A 2: 82,992,684 V6254I possibly damaging Het
Gabra5 T C 7: 57,413,780 T299A probably damaging Het
Gbp11 T C 5: 105,327,598 T295A probably benign Het
Glcci1 C T 6: 8,573,203 Q44* probably null Het
Gpc5 A T 14: 115,399,200 T432S probably benign Het
Grhl1 G A 12: 24,584,858 E228K probably damaging Het
Hyal5 T C 6: 24,891,709 probably null Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ints9 A G 14: 64,993,007 I128V probably damaging Het
Kcnt2 A T 1: 140,375,112 N130I probably damaging Het
Krba1 T C 6: 48,414,128 V717A probably benign Het
Lrp12 T A 15: 39,878,188 D377V probably damaging Het
Magi1 G T 6: 93,943,229 D135E possibly damaging Het
Map10 T A 8: 125,671,245 L459Q probably damaging Het
Mitf A G 6: 98,003,912 D238G possibly damaging Het
Mylk G T 16: 34,921,971 R951L probably benign Het
Nacad T A 11: 6,599,235 D1272V probably damaging Het
Nacad T A 11: 6,600,165 K1009* probably null Het
Ncor1 T C 11: 62,373,298 D786G probably benign Het
Oas2 G A 5: 120,748,538 R188C probably benign Het
Odf2l A G 3: 145,135,718 I300V probably benign Het
Olfr1502 A G 19: 13,861,822 T10A probably benign Het
Olfr338 T A 2: 36,377,196 V140D possibly damaging Het
Olfr484 A G 7: 108,124,430 S278P probably damaging Het
Olfr624 A G 7: 103,670,956 I25T possibly damaging Het
Olfr64 A T 7: 103,893,135 L200* probably null Het
Pes1 T A 11: 3,978,865 D574E probably benign Het
Phf20 C T 2: 156,294,210 R650C possibly damaging Het
Pias4 G A 10: 81,157,264 T248I probably damaging Het
Pkhd1 T C 1: 20,211,951 T2889A probably benign Het
Plcxd1 C A 5: 110,102,167 probably null Het
Plekha7 A G 7: 116,176,898 F194L probably damaging Het
Plxnb2 T C 15: 89,157,770 N1642S possibly damaging Het
Pnpla7 A T 2: 25,011,564 D534V probably damaging Het
Ppp2r5c A T 12: 110,554,879 S279C probably damaging Het
Rab39 T C 9: 53,686,521 D148G probably benign Het
Reep3 A T 10: 67,034,653 F121L probably benign Het
Reln G T 5: 21,901,663 C3236* probably null Het
Rrp8 C T 7: 105,734,809 C162Y probably damaging Het
Scrib C A 15: 76,064,986 Q399H possibly damaging Het
Sertad1 T A 7: 27,489,799 Y182N possibly damaging Het
Sfrp5 A G 19: 42,201,824 V63A possibly damaging Het
Slc46a1 T C 11: 78,467,159 M346T probably benign Het
Sycp2 A G 2: 178,363,416 L886S probably damaging Het
Teddm1b A T 1: 153,874,759 I105F probably benign Het
Thumpd1 A T 7: 119,720,605 I46N possibly damaging Het
Tmod4 A G 3: 95,127,853 N223S probably damaging Het
Tnfrsf10b G C 14: 69,773,401 C85S probably damaging Het
Tox T C 4: 6,697,439 T455A probably benign Het
Tox T C 4: 6,741,536 Q148R probably benign Het
Trp53bp1 A C 2: 121,269,945 S109R probably damaging Het
Tshz2 A T 2: 169,884,968 T26S probably benign Het
Tubb4a T A 17: 57,081,016 N337Y probably damaging Het
Tubb6 T A 18: 67,401,388 V119E probably damaging Het
Unk C T 11: 116,054,946 T481I probably benign Het
Vmn2r112 C T 17: 22,601,278 T44I probably benign Het
Vstm5 G A 9: 15,257,533 G131D probably damaging Het
Wscd1 T C 11: 71,759,883 L12P probably damaging Het
Zfp369 T A 13: 65,296,230 S396T possibly damaging Het
Zfp932 T A 5: 110,009,343 C302* probably null Het
Zfp972 A T 2: 177,906,935 probably null Het
Zfyve21 C A 12: 111,827,594 A212E probably benign Het
Other mutations in Ptprq
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Ptprq APN 10 107576929 missense probably damaging 0.98
IGL00537:Ptprq APN 10 107710522 missense probably benign 0.07
IGL00547:Ptprq APN 10 107718541 missense probably damaging 0.99
IGL00586:Ptprq APN 10 107608122 splice site probably benign
IGL00648:Ptprq APN 10 107646716 missense probably benign 0.10
IGL01123:Ptprq APN 10 107686218 missense probably damaging 0.96
IGL01343:Ptprq APN 10 107638839 missense probably damaging 0.96
IGL01348:Ptprq APN 10 107711904 missense probably damaging 1.00
IGL01433:Ptprq APN 10 107576880 missense probably damaging 0.99
IGL01510:Ptprq APN 10 107712048 missense probably damaging 1.00
IGL01535:Ptprq APN 10 107699596 missense probably benign
IGL01631:Ptprq APN 10 107643538 missense probably benign 0.00
IGL01633:Ptprq APN 10 107699723 splice site probably benign
IGL01702:Ptprq APN 10 107517866 missense probably benign 0.00
IGL01733:Ptprq APN 10 107662599 missense probably benign 0.10
IGL01806:Ptprq APN 10 107699608 missense probably damaging 1.00
IGL01832:Ptprq APN 10 107565839 critical splice donor site probably null
IGL01961:Ptprq APN 10 107643654 missense probably damaging 1.00
IGL02108:Ptprq APN 10 107646617 missense probably damaging 1.00
IGL02120:Ptprq APN 10 107667472 missense probably damaging 1.00
IGL02160:Ptprq APN 10 107653565 missense probably benign 0.00
IGL02178:Ptprq APN 10 107686319 missense probably benign 0.03
IGL02249:Ptprq APN 10 107582359 missense probably damaging 1.00
IGL02267:Ptprq APN 10 107646558 missense probably damaging 1.00
IGL02527:Ptprq APN 10 107686563 missense probably benign 0.04
IGL02529:Ptprq APN 10 107635365 missense probably benign 0.03
IGL02542:Ptprq APN 10 107662555 missense probably damaging 1.00
IGL02582:Ptprq APN 10 107643999 missense probably benign 0.00
IGL02708:Ptprq APN 10 107652700 missense probably damaging 1.00
IGL02894:Ptprq APN 10 107667424 missense probably benign
IGL02903:Ptprq APN 10 107666586 missense possibly damaging 0.51
IGL02951:Ptprq APN 10 107667460 missense probably benign 0.03
IGL02982:Ptprq APN 10 107586684 missense probably damaging 1.00
IGL03000:Ptprq APN 10 107542657 missense probably damaging 1.00
IGL03024:Ptprq APN 10 107685566 missense possibly damaging 0.69
IGL03240:Ptprq APN 10 107688507 missense probably benign
P0043:Ptprq UTSW 10 107580225 missense probably benign 0.03
PIT4812001:Ptprq UTSW 10 107666567 missense probably damaging 1.00
R0200:Ptprq UTSW 10 107685157 missense probably benign
R0268:Ptprq UTSW 10 107705548 missense probably benign
R0276:Ptprq UTSW 10 107542735 critical splice acceptor site probably null
R0279:Ptprq UTSW 10 107608417 missense probably damaging 0.96
R0335:Ptprq UTSW 10 107708728 missense probably benign
R0344:Ptprq UTSW 10 107705582 missense probably benign
R0357:Ptprq UTSW 10 107686199 splice site probably benign
R0454:Ptprq UTSW 10 107582530 nonsense probably null
R0479:Ptprq UTSW 10 107643994 nonsense probably null
R0491:Ptprq UTSW 10 107608175 missense probably damaging 0.98
R0519:Ptprq UTSW 10 107538920 splice site probably benign
R0523:Ptprq UTSW 10 107580220 missense possibly damaging 0.54
R0553:Ptprq UTSW 10 107710627 missense probably benign 0.33
R0746:Ptprq UTSW 10 107517831 missense probably damaging 1.00
R0755:Ptprq UTSW 10 107582539 missense probably benign 0.09
R1434:Ptprq UTSW 10 107586714 missense probably damaging 1.00
R1445:Ptprq UTSW 10 107662562 missense probably damaging 1.00
R1470:Ptprq UTSW 10 107718574 missense probably damaging 0.97
R1470:Ptprq UTSW 10 107718574 missense probably damaging 0.97
R1558:Ptprq UTSW 10 107644043 missense probably damaging 1.00
R1567:Ptprq UTSW 10 107565887 missense probably benign 0.13
R1711:Ptprq UTSW 10 107534699 nonsense probably null
R1720:Ptprq UTSW 10 107686294 missense probably damaging 1.00
R1746:Ptprq UTSW 10 107638830 missense probably damaging 1.00
R1776:Ptprq UTSW 10 107685089 missense probably damaging 1.00
R1822:Ptprq UTSW 10 107718478 missense probably damaging 1.00
R1872:Ptprq UTSW 10 107643999 missense probably benign 0.19
R1944:Ptprq UTSW 10 107582388 missense probably benign 0.23
R1945:Ptprq UTSW 10 107582388 missense probably benign 0.23
R2006:Ptprq UTSW 10 107666546 missense probably damaging 1.00
R2014:Ptprq UTSW 10 107667422 missense probably damaging 0.96
R2015:Ptprq UTSW 10 107667422 missense probably damaging 0.96
R2097:Ptprq UTSW 10 107653493 missense probably benign 0.05
R2172:Ptprq UTSW 10 107590994 nonsense probably null
R2174:Ptprq UTSW 10 107705553 missense probably damaging 1.00
R2248:Ptprq UTSW 10 107643070 splice site probably null
R2404:Ptprq UTSW 10 107686599 missense probably damaging 1.00
R3423:Ptprq UTSW 10 107582476 missense probably damaging 0.99
R3683:Ptprq UTSW 10 107708628 missense probably benign 0.01
R3875:Ptprq UTSW 10 107685104 missense possibly damaging 0.88
R3945:Ptprq UTSW 10 107686392 splice site probably benign
R3946:Ptprq UTSW 10 107686392 splice site probably benign
R3974:Ptprq UTSW 10 107712062 missense possibly damaging 0.88
R3982:Ptprq UTSW 10 107543396 missense probably damaging 0.99
R4105:Ptprq UTSW 10 107572967 missense probably damaging 1.00
R4118:Ptprq UTSW 10 107711920 missense probably benign 0.37
R4175:Ptprq UTSW 10 107711917 missense probably benign
R4231:Ptprq UTSW 10 107686283 nonsense probably null
R4356:Ptprq UTSW 10 107608364 missense probably damaging 0.99
R4435:Ptprq UTSW 10 107685055 missense possibly damaging 0.89
R4678:Ptprq UTSW 10 107685182 missense probably benign 0.19
R4679:Ptprq UTSW 10 107685182 missense probably benign 0.19
R4745:Ptprq UTSW 10 107524253 missense probably damaging 1.00
R4771:Ptprq UTSW 10 107688427 missense probably benign
R4778:Ptprq UTSW 10 107591022 missense probably benign 0.15
R4808:Ptprq UTSW 10 107718507 missense probably damaging 1.00
R4809:Ptprq UTSW 10 107563175 missense probably damaging 1.00
R4818:Ptprq UTSW 10 107710581 missense possibly damaging 0.86
R4845:Ptprq UTSW 10 107653532 missense probably benign 0.00
R4901:Ptprq UTSW 10 107688414 missense probably benign 0.01
R4942:Ptprq UTSW 10 107688429 missense probably benign 0.01
R4946:Ptprq UTSW 10 107525734 missense probably benign
R4959:Ptprq UTSW 10 107686555 missense probably damaging 1.00
R4973:Ptprq UTSW 10 107686555 missense probably damaging 1.00
R5007:Ptprq UTSW 10 107608276 missense probably benign 0.00
R5053:Ptprq UTSW 10 107563202 missense probably damaging 1.00
R5055:Ptprq UTSW 10 107534679 missense probably benign 0.37
R5090:Ptprq UTSW 10 107526089 missense probably damaging 1.00
R5158:Ptprq UTSW 10 107534704 missense probably damaging 1.00
R5163:Ptprq UTSW 10 107524331 missense probably damaging 1.00
R5222:Ptprq UTSW 10 107662564 missense probably damaging 0.96
R5244:Ptprq UTSW 10 107586695 missense possibly damaging 0.62
R5249:Ptprq UTSW 10 107699635 missense probably damaging 0.99
R5503:Ptprq UTSW 10 107688328 splice site probably null
R5508:Ptprq UTSW 10 107686231 missense probably benign 0.00
R5601:Ptprq UTSW 10 107608430 missense probably benign
R5722:Ptprq UTSW 10 107686365 missense possibly damaging 0.72
R5819:Ptprq UTSW 10 107719883 start gained probably benign
R5862:Ptprq UTSW 10 107565878 missense probably benign 0.02
R5891:Ptprq UTSW 10 107576895 missense possibly damaging 0.94
R5916:Ptprq UTSW 10 107523513 missense probably damaging 1.00
R6054:Ptprq UTSW 10 107582358 missense probably damaging 1.00
R6058:Ptprq UTSW 10 107635274 missense probably benign 0.00
R6075:Ptprq UTSW 10 107525760 missense probably damaging 1.00
R6101:Ptprq UTSW 10 107580266 missense possibly damaging 0.93
R6189:Ptprq UTSW 10 107517887 missense probably damaging 1.00
R6235:Ptprq UTSW 10 107635338 missense possibly damaging 0.61
R6394:Ptprq UTSW 10 107642943 nonsense probably null
R6449:Ptprq UTSW 10 107705583 missense probably benign 0.00
R6526:Ptprq UTSW 10 107542653 nonsense probably null
R6544:Ptprq UTSW 10 107608241 missense probably damaging 1.00
R6609:Ptprq UTSW 10 107572968 missense probably damaging 0.99
R6862:Ptprq UTSW 10 107686225 missense probably damaging 0.96
R6874:Ptprq UTSW 10 107718599 missense possibly damaging 0.80
R6892:Ptprq UTSW 10 107576004 missense probably benign 0.00
R7082:Ptprq UTSW 10 107708730 missense probably benign 0.10
R7210:Ptprq UTSW 10 107685171 missense probably damaging 1.00
R7253:Ptprq UTSW 10 107608273 missense probably benign 0.30
R7293:Ptprq UTSW 10 107635506 nonsense probably null
R7445:Ptprq UTSW 10 107590959 missense probably damaging 1.00
Z1088:Ptprq UTSW 10 107699672 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- AGCCCTCTGAAGAATAGCGC -3'
(R):5'- AGTGTTTCTCAAGCTCAATATCCAC -3'

Sequencing Primer
(F):5'- TCTGAAGAATAGCGCTCAACATC -3'
(R):5'- GCAAATAGCTGCATTAGGACAATATG -3'
Posted On2018-04-27