Incidental Mutation 'R6338:Cdh4'
ID514308
Institutional Source Beutler Lab
Gene Symbol Cdh4
Ensembl Gene ENSMUSG00000000305
Gene Namecadherin 4
SynonymsR-Cadh, Rcad, R-cadherin
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6338 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location179442431-179899373 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 179890812 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 689 (V689A)
Ref Sequence ENSEMBL: ENSMUSP00000000314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000314] [ENSMUST00000098996]
Predicted Effect probably damaging
Transcript: ENSMUST00000000314
AA Change: V689A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000000314
Gene: ENSMUSG00000000305
AA Change: V689A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Cadherin_pro 30 121 1.18e-30 SMART
CA 187 272 2.31e-15 SMART
CA 296 387 4.33e-29 SMART
CA 410 503 2.21e-12 SMART
CA 526 610 7.16e-21 SMART
CA 630 715 3.78e-2 SMART
transmembrane domain 730 752 N/A INTRINSIC
Pfam:Cadherin_C 760 909 2.5e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098996
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129659
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.1%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. The encoded protein is involved in retinal angiogenesis during development where it plays a crucial role in the endothelial-astrocyte interactions. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutation of this gene results in dilation of the proximal renal tubules and extensive vacuolization of tubule epithelium. Uretic bud epithelium appear disorganized and exhibit increased apoptosis at E15.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer3 T C 7: 98,257,715 Y128C probably damaging Het
Adam30 T G 3: 98,161,541 I102S probably damaging Het
Adcy8 A T 15: 64,920,617 D163E possibly damaging Het
Agrn C T 4: 156,170,585 E1614K probably benign Het
Aldh16a1 A T 7: 45,141,961 W107R probably damaging Het
Arfgef2 A G 2: 166,845,570 D238G probably damaging Het
Arhgap11a T C 2: 113,833,725 S738G probably benign Het
Arid5b C A 10: 68,098,561 G504* probably null Het
Carmil3 T C 14: 55,499,849 V763A possibly damaging Het
Cd209e T A 8: 3,849,154 D186V probably damaging Het
Cdh23 T C 10: 60,413,151 D882G probably damaging Het
Cntn6 T A 6: 104,726,139 V174E probably damaging Het
Col7a1 C T 9: 108,956,633 T390M unknown Het
Crybg1 T C 10: 43,992,509 D1017G probably damaging Het
Csmd1 T G 8: 15,932,492 K2725T possibly damaging Het
Dnaaf2 T C 12: 69,198,122 E55G probably damaging Het
Fam13a A G 6: 58,953,499 V476A probably damaging Het
Fem1b A T 9: 62,797,011 D322E probably benign Het
Frmpd1 G A 4: 45,274,489 V466I probably benign Het
Gm11639 C T 11: 104,843,208 R2027* probably null Het
Gm20671 A T 5: 32,820,647 D1794E probably damaging Het
Gpatch2 G T 1: 187,225,514 R22L probably damaging Het
Gtf2h1 A G 7: 46,816,456 T450A probably benign Het
Kcnc2 G C 10: 112,271,856 G51R probably benign Het
Krit1 T G 5: 3,836,857 M702R probably benign Het
Krt34 T C 11: 100,038,490 N298S probably benign Het
Lrrcc1 T A 3: 14,547,316 N376K possibly damaging Het
Myo15 A G 11: 60,478,133 E573G probably damaging Het
Olfr1224-ps1 T A 2: 89,156,371 K268I probably damaging Het
Olfr1390 A G 11: 49,340,867 S112G probably benign Het
Olfr366 A T 2: 37,219,822 D111V probably damaging Het
Olfr391-ps A T 11: 73,799,319 L146Q possibly damaging Het
Olfr661 T A 7: 104,688,171 V52E possibly damaging Het
Olfr736 T A 14: 50,393,400 F215I possibly damaging Het
Phf20 A T 2: 156,273,686 Q309L possibly damaging Het
Plcd1 G A 9: 119,074,991 R292C probably damaging Het
Pold3 A G 7: 100,088,105 V342A possibly damaging Het
Polr2a A T 11: 69,739,679 probably null Het
Ptprcap A G 19: 4,156,224 E102G probably benign Het
Rab11fip5 T C 6: 85,341,378 E843G possibly damaging Het
Rai14 T C 15: 10,574,976 D632G probably damaging Het
Rnf149 A T 1: 39,560,742 C268S probably null Het
Slc6a13 T A 6: 121,334,839 F392I probably damaging Het
Slc7a11 C T 3: 50,384,043 probably null Het
Slf1 T A 13: 77,084,462 probably null Het
Stard9 G A 2: 120,697,485 V1408I probably benign Het
Suclg1 T C 6: 73,264,246 I183T probably damaging Het
Syne1 T C 10: 5,255,475 E3497G probably benign Het
Tax1bp1 C T 6: 52,729,376 R121* probably null Het
Tdpoz2 C T 3: 93,652,336 V110I probably benign Het
Ubn2 A G 6: 38,490,714 T788A probably benign Het
Unc13c T A 9: 73,734,447 I1255F probably damaging Het
Usp44 G T 10: 93,846,513 R275I probably damaging Het
Uspl1 A G 5: 149,215,034 N1015D probably benign Het
Wbp2nl G T 15: 82,299,045 W13C possibly damaging Het
Zc3h14 T A 12: 98,758,590 D170E possibly damaging Het
Other mutations in Cdh4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Cdh4 APN 2 179874144 missense probably damaging 1.00
IGL01411:Cdh4 APN 2 179780403 missense probably damaging 0.96
IGL01752:Cdh4 APN 2 179890884 missense probably damaging 1.00
IGL02814:Cdh4 APN 2 179780474 missense probably benign 0.01
R0082:Cdh4 UTSW 2 179894188 missense possibly damaging 0.75
R0357:Cdh4 UTSW 2 179847340 missense probably damaging 1.00
R1521:Cdh4 UTSW 2 179797558 missense probably damaging 1.00
R1591:Cdh4 UTSW 2 179886864 critical splice donor site probably null
R1622:Cdh4 UTSW 2 179889092 missense possibly damaging 0.56
R1762:Cdh4 UTSW 2 179797480 missense probably benign 0.01
R1794:Cdh4 UTSW 2 179886842 missense probably damaging 1.00
R2275:Cdh4 UTSW 2 179890847 missense probably damaging 1.00
R2277:Cdh4 UTSW 2 179797524 missense possibly damaging 0.88
R3686:Cdh4 UTSW 2 179780367 missense probably benign 0.09
R3861:Cdh4 UTSW 2 179874097 missense probably damaging 1.00
R4078:Cdh4 UTSW 2 179889173 missense possibly damaging 0.93
R4495:Cdh4 UTSW 2 179780389 missense probably damaging 0.98
R4715:Cdh4 UTSW 2 179780467 missense probably benign 0.03
R4893:Cdh4 UTSW 2 179847419 intron probably benign
R5029:Cdh4 UTSW 2 179881949 missense possibly damaging 0.93
R5363:Cdh4 UTSW 2 179886763 missense probably benign
R5542:Cdh4 UTSW 2 179860226 missense probably damaging 0.98
R5773:Cdh4 UTSW 2 179885996 missense probably damaging 1.00
R5791:Cdh4 UTSW 2 179895767 missense probably damaging 1.00
R6262:Cdh4 UTSW 2 179797626 missense probably damaging 1.00
R6589:Cdh4 UTSW 2 179881996 critical splice donor site probably null
R6607:Cdh4 UTSW 2 179874096 missense probably benign 0.00
R6653:Cdh4 UTSW 2 179780428 missense probably benign 0.34
R6711:Cdh4 UTSW 2 179890931 missense probably damaging 1.00
R6744:Cdh4 UTSW 2 179847387 missense possibly damaging 0.68
R6824:Cdh4 UTSW 2 179797558 missense probably damaging 1.00
R6901:Cdh4 UTSW 2 179860194 missense probably benign 0.19
R6981:Cdh4 UTSW 2 179797504 missense probably benign 0.28
R7285:Cdh4 UTSW 2 179797465 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATATGCTGTACATACATGCGTGC -3'
(R):5'- ACTTACTTAGCAGGATCACGATGC -3'

Sequencing Primer
(F):5'- ACATACATGCGTGCGTGTG -3'
(R):5'- TACTTAGCAGGATCACGATGCAGATG -3'
Posted On2018-04-27